Description :
From Genome Similarity Track
Location :
Scaffold_104:1001- 4987
Sequence
3986 bases(100 bases per row)
ATCAGATGGCCATCTGATGAACAAGTGCCAGGCATCTTCAAGGACAGCAACGCCAATGCTTCCTTCTATACTGTCGCATAGTTGATTTCGTTCGCCTTCA
GCGTTCGACTGGTGAAATTAACTGGCCAGTACATGCCATCATATTCTTGGATCAGGGTCGCTAATGTGACCCACTTGCAGGCATAGACCACAATAACTGG
AGTTCAATCTGGGTCGAAATGTCTTAACGACAGAGTTGTTGCGTATTCGCTTTGAACATAGTGAAAGTAATTGTAGCCTCTTTCCATCGATATTCTTTTT
TCGTCTTCAGACTGCTAGTCTTTATCCATGCGCTGAGCCCGGCCAATCTCGTGTAAATCCGCTTCTCGAAATTCATACAGCACAGCCGCATATATCACGC
AGTCCTCAATGAAACGGGGCTGAAGTAGTTCAGACTTCCGAAAAAAAGATTGCATTGCCGCAACGTGCTAGGAAATGGGATGTTGACCATCGATTCTAAG
TCCTTTAAGTGCGCTTCGAGACCATCGTACTGGACCTGATGTACTAAATAATAGACCTTGCGATAACTCCAAACACGCTTTGTAAGAACGATCGACAAGT
TCCATTTATTGCAAGTTCCTATCAATCTCTCCACATTCTTACATATACAATCCCACGTCCTTGCCGGGATAAGAATATCGTCGATGAACGATCTTCGCCC
CAGTATGGATGATTGCCGATCCATATTCAGTTTACCTTCTTTGTACTTGTCTATCCTCCCTTCTGAGAGCGAACGTTTGGCGATCTTGAGGTATCTATAG
ATCCATATTCAGTTTACCTTCTTTGTACTTGTCTATCCTCCCTTCTGAGAGCGAACCTTTGGCGATCTTGAGGTATCTATAGAGTGCATGGTCAACTAGA
CGTTGGTATATATGAAGCGCATTCTTTAGTCCGAAGGAAATTTGAAGCCATTCGAAAATTCCGAATGGTGTGATGAACGTTGATATCCACTTTCTCCACT
TGCTCTTTTCCACAACCCAAGAAATCCTCTTGCCATGTCCAACGAGCAGTACCAAAGGGCTTCGTTTCGATCTTCAAACAGATCGCTGACCAATGGCAGT
AGTTAAACCATCAAGCAAATTTACTATCCCACTCTGCGATAGTAGATGCATAGACGAATGTTGACTCTATTATTCTTGATGACCACCATTATAAGAAACG
CCCACGATGAAGTAAAAGGCTGGATAATCTTCGCCGTCAAGAGCCCTTTGATGAGACCGAAAATTTTTCTCCCGATACTTGGGTTCTACTGGCCGAACTC
TTTGCGCTATCGGAGAGGCTGTGATTGCATCTGTATCACAAGTCACGCCGCATGCTTCTAGAATTAACGCATTGACTTCCCTCATGAGGACAAGACGTCC
ATTTCAAATCAGCGCTCTGAGCTTTCTGCTAATCTTCCGTGAGCAGGACATTGGGTCATCGATCAGAATGTCGTCAATAGTCACATCTTCTTTCAATGCC
GCTACTTCCGGCAGTACTTCTATATGATGCTCTACATCCTCAGCAAACAGATCACCGCTCTCGTGATATTAAACTTGTGTCTCTGTGATCTTGTTTTCCT
CGACATCTGACGGCATCTCTATATCTGGGGCTACCTTCATTTTTGCATTACTATTTTTGACTAGTTCACCTACCGGATTGGGACTATTTCTGCACGACCC
ATAGTCTGGTGGTTGGAGATCGATCCTGCGAAATTCATTGTTGTCGGCCAAAGCATCTCGTCATGCGAGGTCAAATCAGCAATATCGACCTGTCCTTCTG
TTGAAATGTCAGCGTCTTTCTCGTGAGGTCTTCCTTCAACATCCTGCTGTATCTTCACTGTGTTTACTGGTGGCACGTCCTTGATCTGGCGGTCGGTCGT
TTCATGATCTGCTCCAGAGTGACATATTTACGATGTTCCACAAGTGGTCCGATCCATTCTTGAGGTGGGTCATTTAGTCGATCCACTATAGCTACATATG
CCAGCGTTTGCCATTTTTGATATCAGCGCGACCCCACTGACACATAGCATGGAATTTTGGTATCATATCGCCTCTCATCTACATTTTCGATATGACAAGT
GTGATCAGAATGATCTTATGATCGCTGAGATTGGTCATCGGGAAACATGTCTTCCTGCCGGGTCCTGCGATCACTGTTGGTACCCAAGTCGGACCTCTCG
TACCCACAGCTTTGCGTTAGCATTCTCGATCTCGACCTTCACGCTCTTGAGTCTCCGGTCGATATTGATACATGTTGATATATCGCTATAATATTCTGTA
TCTTCGAGTTATATGCATGACACTGTTCAGAGCGATGAAAACGAACCTCATCCGGCAGACATAGTGTACCGTCGGCCACATCGAGCCGTACCTCGGCGGA
TACCATGAAATCCATACTCGAAAACGCTTCTTCATATTGATCTCCCACCCAAACATCGAAACGTTATATACTAGTGATCCAGCGAGAGTGACCTTGATCT
TAGTGCATCCTGTCGTCATGTAAATATTCGCCAACCCCTATACATTCTTGTCGTTGACTTTTGTCGATAACACCACCAATCTTACGAGTAAAGGCGGTGC
CAATGATGAATAATTCAGCACCAGAATCGAGTGGCAGGGTCGCTCTTTCGTTTTTTAACTTGCTAATTGATCTCGCCTGCTTGAAACATATCCCAGGCGC
GTATTTCTAATAGTCGTGAATTCCCCACGAGCGAGTTCGATCTCCATCGTTGGTTCAGACGCGAGTACTCATTGATCTTCTTTGAACTAGAAATTTTAGG
AAGATATTGTTATTTCAATTCAGATATAATCGATTTCATAGCTTGCTGCATATTCTCGAAAATCCATCTGTCTTTTTCCACAAATGGGAAATATCAGAGC
CTAGAACGCTCGGCTCGTACCATATTCCTATCTGGCGAGCGACCTAGTTTAGCTTATTCTCGACATTCAACATCCCTTCATGTTTAGTGGGTACATACCA
GAGGCGGATAATGTTATAGAACTCCCCCATCAGGCATTTCCCTGGTTCATGCATCGCACCACAAGCCCGGTATACTAAGAACCAATTGTCGGAGGGATGT
CCGTTGCGACTATAAATTTAGCGCGTGAGCCGTTTCCAACATACCAGATCGCCATGTTTGGTCGATTCGCAGTAAGTTCACGGCTTCGTGGGTATACCGA
GTCCCCGAAGATCTTGGCGATTGGTAGGGCCCGTCGACTTCAGGCGTGCCGAAGGGTCCCTCGTTTGCTTTTGCTGATCGGGAGCAGTGGTTACATGGAT
CAATCTCAAATGATCCCTTGGTTTCGATCCTATGAAGTCAGATTCGGACACAAACCTACTTATCGTCCGTTAGGGTCGCCTTCACTGCTCGCGCAGGTTC
AGATGGTCCGGAGTTGATGCCACCTTCCGCCGAAACTTGGACAATCCCATCATTGCCTTCCCATGACGTAGACTCCTTCCTTGTTACTCACACAGCGTCA
TTTACATCGTTGCTGCGTCTTTCACATGCCAGAGCATTAGTTGGTGGGTGAGATCTGGATCGTCCAGAGTATCAATAAGATATTCGATATGTTCCTTGCA
CTCGGCTGGATATCTGGTCTTCACAGGTATCTTCGCTTGAATTCCAATCATGTTGATATGGTACATATATCCGAAAGGCATTTTGCCAGGTATTTTCTTC
ACGTGGTAGAACTGCCGTCTTACCTATACTCCATGTACAGAATTCTGCACCAAGAAAATCCCCATTAGATTCTTCCATTTAAATTGTGTTGATCTACTCA
ATTGGTGATACCAGTAGCAGGACGGTCCCACCATCAGGTCGTCAAACACCGAACACTTCTCATCATCTGAAGTTTGATCTTGGAGGAATGCCGACTTAAC
TTTGCCGATCTAGTCCTGCGCTTGATCTTCATCCCGATCCTTGTCCAAGAACTCTTTTAACTCCAAAAATACCGATACTCTGATTC