Description :
From Genome Similarity Track
Location :
Scaffold_3185:1001- 2415
Sequence
1414 bases(100 bases per row)
ACCGGCGCCGGCTGCCGGAAACACCAGCACCCATATCGGCGGCACGGCCGACCGCTGCCGCCTTACCGGGAGCTGCACCTGCTCCAAGATCGCCGCACTC
GCCTCTTTTATCGTCGTTGGCAGCGCTGGTGCCTATATCAAAAGCAAAACAAAACACAATTAGTCCACGGCGTCTTCAGCACCCCTCAGTTCGGCCTCCG
CCTTCAATACCTTCTTCAGCACCGACTTCGAGGAGGCGCGTCTTCGCAATGTACCTTAGGACGGCCATTTCTCCAAGTAGGTAGTCAGTCCCATCTTCGC
CGTCGTGTCGCCTTCCAGGCCGAATGTATTTGTAGCGTGTGTCCAAAGACTTGGTAGAAGGGCTGCTTGGACGTCCACCGGCCTTTGCCAACACTCGCCC
ACTCGCTGTTGAATACCAGCAGCGCCCCCCGAGCTGCTCGCTGTCTCATCAGGTGCCTCCTCGCTATCGGTATGCACGCGTCGACGCTTCCTTGCCATAT
CAGTGCCTTCATGCCTGCGCTTCTGGACACGCGGCACTTCCGACATTTTCTGCTTGATTTACAAATGAGGGCGGGGACGGATGGACGGCTGATACGCGTC
GCCTATATGTGGAGAGTATAGGGTACATAAATACATATATTCCATCACGACTTGTTTTTTTATATACATTCAAACAAAGAAACAATAAATTTTTGGGGTA
GCTCCATAATTTTGGCGCCAAGTTTGCGCGGCAATTCTAGTATACAAAATGCCACATTCAAATACAAAGCATAAGATTTATGCACCACTGCACTGCGTTG
TAGTTACACCATCGCCGGCCATACTGGAATAGACACATATGCAACCTAGTGTTCTACACGCTCAAATCGGAACCTTGAGCACCTATAGCTTCAAAACTAA
AGGTGACGCTTGAAACAGCATCTCCAAAAGCACCCACAAACGTATAGCGGCTTACATGTTATCGCGGGAAACCAGCGGCATGATCTCGCCGGTCAACACC
ACAATACTACATAATGGCGCGAACTTCGGAAGCTGCAGCAGCGTGGGCATCATCCTTTGACAAGTCATCATCCAGAAAACGGTCAGTAGCGCGAATGTCT
TCGTAAGTTTCGCCGTTATATTTCAGCGGTGGTACGCTGTACCGAATTGTTTTGACCAAATCATAATAGAATCGACCTCGAGTTGTCTGAGTGCTCACTT
ATTAGCCAATCATAATGCTACCTTAAAGAGCGCAAAATTCGCCCTTTAAGGGCAAAATACGCCACATCAAAACTGCATCAAGCTTGATTTGCACACCATC
CCCGTCTTTACCAATACCTTAAAGGGCGAATTTTGCGCCCTTTTAGCTCTTATTGACTTGACCTGTATAGTATAGAAAAAATGGGCTTATATGTGCTCCT
CGCGAAAGGGTTAA