Description :
From Genome Similarity Track
Location :
Scaffold_13:1000727- 1007281
Sequence
6554 bases(100 bases per row)
CAGGCTCTGCCGCCTCCGAGTTCTCGTGCGACTGCATCGCCTCAAACCGGTTGCGTCCCGTGCGCCGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATT
CAGATCGAGCTCGTCGACCCACGTCGTGTCCGGGTAGCCTTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCGCCCCTCGCGC
ATATTCACGATCTTCTCGACCTCGAAGACGTCGTCCTCCAGCTCGCGCGTGGCTTCCCAGCTATCCTCCGGCAAGAGCTCCTCGTCGAAGTCGAAGCGCT
CCTCGGCCGGCACCGTCAGCTGCGTCGCGGGTCGCGACGGGAATTCTCGGATGGGCTTCAGCTTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGT
ACCCGCCGTCTCGAGGCGCACTGCGAACGCGCTGACCAGCTCGGCGACGCGGAAGGGTCCGTGCCACATGTGGGCGAGTTTGCGCACATACCCCGGCTTC
ACCCGATCCAGGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTTGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGA
CTAACTCCAACGCTTGTGCCCTTGCCACCTTGTAGTGTCGCTGGATACGGAGCCTCCGCCGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGC
CAGTGTCGCTTCCAGGGTCGACCGAGGATCCCAGCCATGCACTAAGAAGAACGGGGTTTCGTTCCTCGTCCGGTCGTGCGACGTGTTTAGCGCGAAGGTA
AGACGCTCGGCGTATTCGTCCCAGTCGCGTTGGTCGACGTCCGCGGTGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGT
TGGCTTGGGGACGATAAGCGAGCGTCGCTCGCTGTCTCTGACCCATGAGTTTGCTGAACGCCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTG
GCGGATAGCCTCGCTCGCGCCGAAGCGCCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGTTGCATTCGCTTTGACCACGACA
AACCCCGTGAAGAGGTCGACGCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGT
ACGTCGCGACGATGTTGCCCGGCGACTCGCCCTGGATGGTCGGCCGATCCTTTCCGGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCT
GAAGATCCCTGGTCAATGGAAGTGGCGCCTCACGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCCTCCAGGCTCGCGTGATAGTGGTGGAGTACA
TCTTCCCGAAGCGTCTCCGGGATCACCAGCTTCATCATCACATCCCGATCCTCGGCGGAATCGTCACTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGC
CCTCTTCGTACTGAGGCGCAAGCTTTTGGCAGTTCTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCTGCGGAGATACTTCTTGAGGTTGACGATCCA
GACCTCTTCGTTCTGGGCGACGCGGATGCGGTCCAGGCGCAGTCGTTGCACCACCCGCTCCTCCAGGACTTCTGGAGGTCGGACCCTACGTGTTTTCGTG
CGTGCGGCAGCCGAGCGCGTCGTCACAGCGAGGACTTGTGCTGTCCCGCGTCCCGCGTCCATGGATTTCCCGACGGGGTCATTTGCGCCGCGCGTTTTCG
CGTCACGATTTTCCGCGTCGCGATTTTCCGAGTCGAGGTTTTCCGCGTCGAGATTATCCGCGTCGGGACTGGCTGGAGACGCCATCCCGGGACTCGATGC
CCGTGGTCGGATGACTTCTACCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCCTCGGGACTGTGCGCGTTGCGGCCTCCTTGACGCTGCAGAGCTTGT
CCAGCCAGCATGTCGGCACTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGGCGCGGCCATGCCTGGAGTGCGTTTCGCGTCTTTTGTCGCAGCA
GCTTCAGCCCCGGGGACTTGCAGTCCATCTCGTCTCGCATCTGCCTGATGACAAGGTTGGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCGAGCTC
CTCTAGACGAGAACATCCGAGCAGCAGCCCGCGGTATTCCGCCTCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGCACGATCTCCCAGTTC
GGCAGCTGCCAAATGACGGCACTGTATGCTCCGCCTTCTCGCTTCGCCTTGGCCGATCCGTCAAAGCTCAAAACGTGCAAGACCTCGTCGCGCGCCTGGA
ATGACTACAATCCTGGACGCCCGTCTCCATGGGGCGATCTCTTCTAGCGCCGCGTCGACGAAGGCTCGCGGGGTAATGCTCGCGGCCAGCGCGCCGAGGA
GTTCTTCTTCTCCCTTCATGGATCGGCAGATTTCCAACTTCCACGGCGAGAGGATCGCGGCCCACTGTGACGGCCGCCCCTGTAGTCCTTTGGACCGGAA
CAACCAGGCGAGCGTCGTGTGACGTGTCAAGACGCGGACCGGTCTCCCTGCTAGCATCGTGTAGCACTCGTTCAAGACGCGCAACAGGGCCAAGATCTCC
TTTTCGACGATGTCGTAGTTCAGCTCGTTGGGCTTCAACGTACGACTGGTGAACTTCACAGGCATGTACACTTCGTCGTGGACCTGCGTGAGCACCCCTG
AGATGGCCCAGTCGCTGGCGTACACGATCACGACGGATTCTCGGTTCGCGTCGAAGGGCTTCAACATTGGGGTCTCGGCGAGTTTTGCCTTGAGCGCGTC
GAAGGCGCGCGTCGCGTGCGTCCACGTCTCATGTCCGTGGACTTCTGGACGCTTGGCGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTT
GCATATACCGCAAAGTCTGCAATGAACCGGTGGTAGTAATTGAGGCTACCCAAGAACGATTACAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCA
GCGACTCCAGATTCTTCGACTTCGCCTCGAGACCGAGTCCTGAGACTCGGTGGCCCAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACT
GATGGACAAGTGCCGCTGCTCGCAGACATCCTGCAAGCGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTACCCCCGATGAGGATGTCGTCGATGTAC
GACCTCCGTCCCAGAACGGAGTGAATACCTGGCTTCACCGGTTCGCCGTCTTCAAAGACGTCCTGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGT
AGAGCGCGTTGTCGATCAAGCGTTGGTAAATCTGCGGCGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGC
TGAGGTGAGCCGGGCCCGGTCTGTCATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACGGATACTTGTCCAAGTCTTCGAGCAAG
TCGTTGACGAGCGGCATGGGGTAAATCATCAACTGTGTCAGCCCGTTGATGAACCTGTAGTCAATGCAAAGCCGGATATCGACGCCGTTCTTCTTAATGA
TCACGACAATGGGCGACGCCCACGGCGACTTCGACTTCTGGATCATCCTCGCGCTCAGCAGCCCTTTGATCAAGTCGGCGACCTTCTCTCGAAACAGCGG
CGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCGATGTCGCAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCG
ATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCCCGTGGCTTCCTCGGGCGGGAGTCCAGTCGGCATGCCGACCTTCAAGT
CCTCGATCTTCACCTCGGCGGTCAGCGAGAGATCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACGAAGAGGCCGGACCCCTCGTGGATGAGGAC
CGCGTCTTCTTCCTCCTGCTCATCCGGTTTTGCCTCGTCGCGTTCCGGCTCGGCGGGTTCTGGTTCGTCGAGTTTCGGCTCGGCGAGTTTTGACTCAGGC
GATTCCTTCATCGCAGCGCTTCCAGCCACTGTCGGAGGCCCATCGGGTTCCACTTCCACCGCCTCCTCGCCCGTTTTCCGCTTGTGGTCGTCGGGCGGCA
CCTCTACCCCGCTTCCCTTCGGCGCGCTCGCGACAGCCGCCAACACTGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGCTCCGGGCGCAAGATGGCT
TTAGGCGTCGGGTATGAGGGGCGATTCGTCATCGGCCCGTCGAGCTCGGCTAGGATCCAGTTCTCCTCCGCGTCGCGCATCGCGCCGTACGCCAGATTTT
GCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGAATCCACGATTCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTTCATGCGCGTCGAG
GGTTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTACGTTTTCTTTCCGACTCTCCCCTTGCCAAAGGTAGTCACCCACGACTCTGCCCGTGTCACC
CACAGGAACGGCGCGTATCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACGTTGACCGGGTGCATCCGTG
CGCCGTATAGCGGTCATCTGGATATGCACCTCGTCGAGGAGGCACGCCGTGCCATCCGCAGTACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGC
GTGTTGGCCGACCAAGTCGCCGACCCACAGGTGCATGTAGTACACCAAGTTACCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTC
TCATCACGAATTCCCACACACTCTTGCGTGATCTCTGTGTCGATCAGGCAGCCTACCTCACGAGCAAAGGTGGTGACCAGGATGGACACCTCGGCACCTG
TGTCGAGCAATAGCACAGCACGGCACTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCGCGTCG
CTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCTCGACGCGCGTTCTTGC
GTGGTACGTTCCAGGTTGGATTTACATGTATTATCATTCAGGGAAGTCGGGCTCTCACAAACCGCCTCTCGCGACTTCTTCGTCACATATGCATAGATGG
AAACAGGTCGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCTTAGTTTAACATCTTCTCCGCGGCCGGTGGCAGCATTCCCGCGTGTTTATTCGGG
TCAAACCACTGGCGCAATTGGTTGAAGAACTCCTCAATCGGGCATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAACCATCGCTCCG
TCGGGTGCTGGCCACCACACTTCTGACACGTCAACAACTTCCAGCAGTCTCCTTCGACATGGCGACGTGAACCACAGTGGCGGCACCGCGGGCGGTCGCG
TCCCGAGTCGTCGGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGCCTGTCCCGCGACGAAGAACTTGGCGCGTTCTTCGTCCGCCTCGTCTTGG
TCGTACTGGCGATCGTCGCTGTCGCGACTTTCGCGTTCCGAGCCGTACTCGTCCGACGCAACGTGAATCGCATGTACGGCGCGCGCCGGCGGAGTCGGCG
CCTTTTGGCGGAACTTGTTCAAGCCGAAGAGGGTCTTCTTCTGGTGAGCCAATCCACGTTGTCGGGCACGCAGCTTCATCTCCAGCGCCGCGGAGTCGGC
GACCTCCATCAGCGTGAGACGCGAGGCGAGTTCGGCTTCCTGCGTGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTCTCTTCAGTCGTGCCC
TCGGCGTATGGGATGTTGGCCCTCATGCCCGCGACGCTGAGCCGGTACAAGTAATCCAGAGGGGTCTCGTCGGGGCGCTGAACCGCATGGTAGTAGCTAC
TGGCCATTGACACGCCCTTGCCGCAGTACTGCACCCGGAATTGCTCCATCAGCTCGGTCCACGATTTCTTGACCTTCCTGGACAACTGGAGATACCATTG
GCGCGCAGGGCCGCTCATTAGATCGCTGAACTGCCCGCACACTTCTTCGCCCGTCATCCCGTCGCGCCGCGCGGCGGACTTCAGACGGTTGAGCCACAGT
CTGGATTTCTCTTCGCTGGCGTCCCGTCCCGAGAACTCTTTCAGCTCGGAAGATGCTGAGAGGCGTACGCGGGCGAGGGCTACGCCGCCGGCTGTCGCCG
TCGAGACGGCGGCCGCGGTTCTTGGCACTCCGGTGTCCAAGTCGAACAGGTCAT