Description :
From Genome Similarity Track
Location :
contig_36:100061- 102403
Transcript NameFunction/comments
g7447.t1hypothetical protein PHYSODRAFT_560674

Sequence
2342 bases(100 bases per row)
TTCTTGAAAACATTTTCGTATCGTGGATTTCCAAGCAGCGTGCACAGCAGTCTCAGCGCTGCAATAACTGTTGATGGAGTAATACCAAATGAAAATTCGG
TCTCGTCACCTGGAAATAGGAAATATTCAATCCAGCGTAGACCCAGATACTTACGGAAACCTGTCAGTCGAGTCGCGCTTGGCAATTGCATTCGTGAAGC
TCCAGCACCACTCGTGTTACTTGACGCAGCAGCCATTTTGACTGCATTGCTAACACCCAACTCTATTACTGAGCTGTCCGGATCATCTTGGTAATCTTTG
CTTTCCTTTATATCCAGTTTTTGCACCGCCTTCAAGAGTGTTTCCAATAGAAGCTCCTGGATCTTGGCTTGATGCGAGATTAAATGTGCATTTACCCACT
TTGTAGGGCCAGGCTTCAATTCTGATACCTTTTGCCCTTGCTGTACGTTCCAACAATTACGATCTATTCTTTGAGAGCCCCTGGGACTTAGGCACAGTCT
AGCTGTAGGACTCGCAAGGGTATGCGCTTTAAAACGAGCACCATCTTCATCGCTTGCGTTGCGCCTTTCATCGTCTTCTTCCACAATGATTTCTTCTTCG
GCAGCTTCTCCCCTGTAGTGGCCAAAGCGTGGAGACAACGTGGCTGCAAGGAAGCTCGTTACGTCTGCAAAATTTGATTCCACAGTTGACTCACGATTGG
GGCTCGTCAAGCAAACCAATATTACGTCTACAATAACTCGTAGAAGATCGACCGTGACGGTTGCATCCATTAGAACGTAAAGTAACTGCCGGATGAAGCT
CATTGATTGCAGCTGTGCTCGATTTCGTTCACGAATCGCCTCGTCGTCAGCAGCCAAGCACGAGTAAAGTGTTGAAAAGAGTACCTTTGCAGTATCCACA
CCAGGCGCCTTCTGCCAGAGTGAGTAGTCCAGAACAAAGTACTGCAACGCTTGCACATTACGGATCGCACTGTCCGGGGAAATTTGAGCTATCGTTTCCA
ATTGCCGTTCTGGCTTCTCTAGCTCGATTTCCACACCAACAATACGAAAAATAATCTGTAGGCATGTGGTGTTTAAAACGATGCCTTCTTGTGTAGAAGA
TAGTTCACAACGCCATAGCCATGATCATACTCCATCGCTGCCAGATTGCGCGAGTCACCTTGCATGAAAAGCCAGAGTAGACTGAGAGCCAACTCCACTT
CCTCGTCTGTCGAAGCTTCGTCTAGCAGCCCGTACGCAATTTGACACCCAGAGCTACTGATGTCGAACATGGCAGATGCCATTGTCGCGGCCTCACACAG
CACAGTCCCTCCCATGAGATGCCCACTTGGACGACCATCAAGCCTACTGTTGGGAATAATCAGCAACTCGTTCGCTACTCCATTTCTGGCTGAGTATGCC
ACCACAATCCTTTCAGACGGGACGGGAAGATGGATCAATGGCACAGCGCTAGGAATGCGAGAAAAGACGTTAGCACTTAACTTGATATCCTGGACGATAG
CTGCAGCCGTACTCGATGCAGCTGAAGCAAGCGATAAACTCCGGCGGAGAAGCTTGTTACGCCCACTACGCTCAACATCGACGGAATCGATAAGCGACCG
AACAGGGTCCCACATGTATGAATCAAGCACCTCCATGTTCGTTATGCTCAGATGATCAAATGTAGCCGCGATTTCGTTGTTTCCAGCAGCGCCGAAGAAT
AGCCGGTCGTAGGATGGCCCCGCTGCGAACACGGCATTAACCACTGGCGCCGAAACTGGTAGGTCAAGCAAGTAAAATGGCCCTACCATCCATCTCACAC
TGGAACACCGACGAGCCTGAGATGGCACGCCTAATAGCCCACTTAGTGGCTGGCTGCCCGAGATGCTGGACGGATATGAAATCTTTACATTTTCCTGCAA
AATCCCATTCAAGTAGCAGGAACCATGCTGGACTGGAAGCGCTGCTTAGCATGAGTGAAAACGACGTGATGCCATTGCCTCGTCTTGATTGGCGTATGCG
AAAATTGGTAGACTGAGGCGCGGTTTGAGCTCGTTCGCATGTAAAGCTTCCCTCCTTTTAGAAACGCTTCACTAACCGACTTGCCGTCGCTTGAGCGCAG
TCGAAAGAGATAGAACATTGGTGGATTGCAAACGACGCACTCACCGCCACTGTTCAGAAGCGCCTCAACGCATCCTCGGCACGCTCGGTGGGAACATTTC
AATACATACTCGTCCTGCACTTTTCCGCGGCAATGAATGCACGTGTTCGACATAAAACTCTCGGTATAGCTTCTCACGCTCCTCTTTTCGTTCAAACGAA
TCCACTCGAAACCATACCATGACCGAGTATCCATCGGGTGGA