Description :
From Genome Similarity Track
Location :
Scaffold_18:100058- 101983
Sequence
1925 bases(100 bases per row)
AGTCCAGAATGAGCGCGTTATACTCCGCCTCATTAGCTGTAAGACCCTCCGCGTAAGAGATTCTGGCTCTTACCAATTTCCATTCGGGCAGTCTCCATAA
GATTGAACTGTAAGCACTCCCTCCTCGTCGCACAAGAACGTATAGATCTTCATCCACTTGCACCGTCGGGATCGGAATATGGGCCTGACGTTTAGGCTCT
TTCGAAGGAGCGATCTTAGTCAATGCTTCATCCATCTTAGATCTGAGCATGATGCTCGCTGCGAAGACGTCTAGAATCTCGTCTTCTCCTTTTAAACATT
TAACGATCTCCAGTGTTTATGGTGAGAGCAGGGCCGCCCATTGTCCCCATCGTCCTTGCAGACCGGCCTACTTAAACAGCCAGGCGAGTGTGGAATGTCG
AGTCAGGATCCGGTTGGATCCCCTCACCAGCAGGTTATAGTTGAGTTCCAACACCCGTTGAAGTGCTAGTATCTCTTCTTCACTGCTCCGTAATTTAGCT
CGTTGGGCTTCAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCTATGTGTGCGCTTAAACCAAAGCCGCCGAGGGCGCCCAATCGCTGGCAAAAAA
TTTCACCGTAGGCTGGCGTTTTGGGTCAAAATGGCGAAGGATGGGCGTCGACGAATTCCTGTCCTAAGCTCCACAAACGCATGGTAAGCTCGGATCCACC
GGGGCTCCACTTCGTCTAAGATCCCTATTGTCAGCTCCGGCGAGGTTGGATCCTCTCCCACTCGGTCCCGAGGTGGATTTAGTTCCTGCTTTAGGTTGCC
TCCCAACGTCGTGTCAAGTGGATCCACGGTCTCCAGGGTCAGCGCTTACTGAATCTTGGTCCGGACAGCCGAAGTAGCCATTGCGGCAAAGTCCACCTCT
CTTAATTCATAGCCAACTGCGGCGAAGAGTGCATAATCCTCAGCTAACCGACTGTAGTAATTCGAACCGCCCAAGAAAGATTGTATCGCTCGTAGCGACT
GCGGGAAAGGTAGATCCGCCAATGAGGACAAATCTTTATATTTGCCTCCAATCCCTCGTTACAACCGTGATGGCCTGGGTAGTCCACCTTGCGCATTCCC
CTGTAGCTTTTCGCCACACGGATAGAAAGATTCCATTTTATGGCACGTCTCTTGTAGGGATGTCATTCTTTCACACCGCTGATCTCACGATTCAGCCGGG
CTCAAAATGTCGTCGATATAGGATCTGCGCCCCAGCACAGATAGCGTCCCCAATTCGTCTGGTTCGCCTGCTCCGAATGGATCTACTTCCGCATCGCCTT
CTCCGGATCCACACCCTTCTATTCCCGGGATTCGAGTAAGCCCGTAGAGGGCGTTGTCGATCAGACGTTGATAGATCTGGGGTGCGTTTTTCAACCCAAA
CGGCATCCGGTTTCACTCGAACAGTCCAAATGATGTGATGAATGCGGCGATCACGCGAGCTCGATCTTTCATAATCACCACCCAGAATCCACTAGTCATA
TCTAAGGAGCTGTACCAAAGTACTTTATCCAAATCTTCCAATAGCGCATTGATCAAAGGCATCGGGTATATCATCGGTCTGGTCAGACCATTAACCATCC
GATAGCCAACACACAAATGCATATCCACCCCGTTCTTCTTAATAATGATCACCACAGAAGGCGTCCATAGGAAGGTTGAGAAGCTGATGGTCTTGGCTCG
CACCAAACCTTTAATTAGATCCGATAGTTTTTCACGGAATTGGGGTGCCACCTTCCGCACCCTCTGATCAATCGGCTTTGCGTCGTCGACATCGATATCG
CATTTGACTTCGTGTGCGGCTGGTGATAATGCATTACCCTTACCAATTAGCAGGTGCCGGCTTTCCCAGATTTGCTGCCGTAGTCGGTCCACTTCCGCGG
ATTCGCTCGCTCCCGGGTAGTCCAC