Description :
From Genome Similarity Track
Location :
contig_64:100020- 101865
Transcript NameFunction/comments
g11025.t1ETP53761.1 hypothetical protein F442_01356 [Phytophthora parasitica P10297
g11026.t1ETK95761.1 hypothetical protein L915_01339 [Phytophthora parasitica

Sequence
1845 bases(100 bases per row)
GTCGTTCACGATTGCTTGTCTGCTACTGAAGATCGGCCGTGAAGAAATCCCGCGCAAAAGAACAACGTCGTGGTTCAACACTTGCTTCTGCCTGGGTATG
ATCACGTTGGGAATTCTTGCGAATGCGTTCTCCGATATCAAGGCGCTGTCGTATTTCTTCATCTACTTCGCCGTCTTCTTCCTGGTCGTGTTCCTGATGC
TGACCCGCGTGAGTCTGCTCAAGGGATTACTCTACATTTCGCGCAAGCTGTTGCTGCACTTCCGAGGTCACAGTGAGTCAGTATCCATGCAGCAGCTCTC
GGTTCAGGGCCAGGCTTTTGTCGGCAGTGTGAAGATTGCCAAGACGATCGAGACGATCAAGAACACGCCTGTGGTCTTCTTCTGCAAGGTGGCCAACTTG
CCCAAGATCAACGAGGCGGTGCGGTACGTGATGCAGAACGAGCACACGTACTGCCTGCGACTCGTTCACGTGTGCGAGCCGAAGGCGCCTGTGCCGCGTG
AGTTTGAGCACGTGGTGAACTTGTTTGACCACATTTACCCGTCGATCAAGATCGATTTCATCGCCGTGACGGGAGCGTTTGACCCGGCGATGGTGCAGTG
GCTGTCGAAATCGATGGCTGTTCCTACGAACATGATGTTCATGCGTCAACCCGCTAACGAGAACATCCACCGCGTGTCGGCGCTTGGCGTGCGTGTCATT
ACGGATTAGACGTTCACGAGTCTACTTCGGCTAGCGAGTGGACTTGCTAAGTTAAAGAGAGAGCTCGAGTTTGCTGTTTCGTGTCAAGGATGATCGCACC
GCTTTCCGGTATCCGGATACTGTACCTACATGTTCACGTACATGTACACGGATGGTTTGGAAATTGACTTTCGGTTCGCAGTGGTAGACTGCCGCAATGA
TTGCCAGTTTGCGACAGGTACTGGTACAAAAGCTCACGTGTGATAGGCAGGCACTCTGCAATCATGGGATGTGACTCCGATTAGCATGTCCGACTGCCAG
TCGGCGACTGGGGAGTTGGTCATTGTCCATTTCTCCAGTTCAGACTGAGAGCGCAGTCGCCGCCGCGTCACTCTGCAGCGGCATGTCGTCGCCTCTTTTC
ATCTTGGCAGTGTTCCTCGCAATAACTGCAGCAGCTGAGCACCGCAACACGCTGCACAACTTGCAGAATGAGACGATGACAGAATGGCCATCATTGCGCT
TCCATTTCACCATCAAGCGCGACGCCATGCAAGTTCACGGCCACTCCGAGTTCTCTGTGCTGGCTAACCCTGTTGTGTCCACCAATGGCGATAACAGTGA
CAGCGTGCTGTACGACACCTTTGCTACGTTCGAGGAGGACTCGATGATGCACACCTACACACTCGTAGACGGTATCGCGTACGTCTCCGAGAGCTCTGTG
GACGATATCAGCGTTGACCCTTTGGTGAAATGCGTGGAGTCAGGAGTTCTGATTCCAATCAACTCGATCGTGTTGGCACTCAACGAGGCTGTTCCTGTCT
CGAGTATCTCATCGAAAAGTAGCGGAACCATCGAGTGTTCCAGTGGGAACACGTTCAAAGCCACAGTAAACGGTTTTGATCTCGGATTGTGTTTCTCGGA
TTCTTCCGGATTCACGATGTATGGCAACGATATGAATATCGCCGTGGAGTATTTGGAGAGTCGTGAAGACATTGCCGCGCCAACGATCAAGAGTGACGTG
AAGAATGAGTGCGAAAAAGTGGCGTCGGCTAGCTCAGTGACATCGATCGGGAGGTCATTTCTGACTGGGGCATCGATTTCTCTCGAGGATACGAGAGAAC
TGCGAGCTGCGTTCGATTTCGATTTCTCGATTGGTGATGATGATA