Description :
From Genome Similarity Track
Location :
Scaffold_351:1000- 5810
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_351-snap-gene-0.11Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_351-snap-gene-0.12Conserved gene of unknown function

Sequence
4810 bases(100 bases per row)
GCCGCGATGGGACAGGCCGGCTCGGTGGAGCAGCGCAGCGCCATCCGCGCGGTCGTGAGCATCCGACCGGGCGACGCCGACAAGCAGCAGATCCTCGACG
CGCTGCGGGCCTTCAGCGCCGCCTTCCCTCTCGAGGTCGTGGCGCTGCGAAGGATCCTGTCCTTGAAGGTCGTACAGCCTCACAGAAATATCTCTTGTCT
GCCCAGTCTGTGCAGGATGCGCGCGATGCGGACGCGGACGGCCCTGTTGCGGGGCCGCTGGGAGTGGACGTCAAGGAGCGGCGGCTGTTCGACGCGGTCC
ACGCGTTGCTGCAGGAGCAGGCCGAGCGCACTGAGCGCGGATCCAACGAAGAGCTTGTGAGTCCCGTCGCGGATGCTCGATTTGTTCAGTGTGGACGCAG
TCTGATTGTGTTGTGGACGGTCGGAGTAGATGGAGCTGCTGCTTGTGAGCTTCAAACGGATCATCCGGTGGCGGGAGATGTACCGCCTGTGCGCCAAATG
CGCGATGAAGCCCTTCCTGAGCTGCTTGGTGAGCTGGAGGGCCGTTCTTGACGTGTTTCTAGCAGTCCTGCTCAACCTCCTTTGTGCGTTTTATAGTATC
TATCGCCCAAGCTGGTGCAATCGGCGCTGGACGCCATCGCATGCATGATAACGGCGCCACCAGGGAACGAGGCGAGCGAGAAGGCGGATCGCTGGGAGAT
GGCCAACCGCCGCAACTTTGGTGAGTCCGGTGGCTACGAGGTGCTGCGCTCGCTTCTGGTGCAGCACAGCGCCGAGAGCAATCGGTCAAGCGAGAAGGAT
GCCATTCTAGTCAACGTCGTGCTGCTTTTCCACGTGACACTGGTGTCCAGGCGGACCACGACCGACTTCCTCACGTGTTCACAGGTCAGAGAGCCTAAGG
GGAGGGATCATTGTTTGACGAAACGCTGATCTCTACTGTTCAAAATGTCCAACCAGGCGGTTGGCGCGCTGCTGAACGCGCGCATCTCGCTGCTGGAGCT
GTGCCACGATGCAAACACCTTGATCCAGGATTCGGCTATCGATTTGGTGAAGGAGCTGTTCTCGATGACCGATCTGGACCAGGTGCATGACTTGCAAGAA
TCAGCGAGAGAGTACGGTGCCCTGCTTTATGTGCTGTCGATGGCACTGAGTGAGCCGGTAAGTGCTGTAGCATGTATTGCTCAATGCTCGTCAGATAGTT
GGGCTAACAGTCGCACTATGCAGCGGCCCAGCACCAGCTCCAAAGACGGTCGCTTATCCACTCCGACGAGCGCGTCGCCGACGTCACTCTCGCTGCAACA
GAAGTGCATCGACCTTGTCGAGATCTTTTGCGCTGGGAATACGAGGACCAAGAAGGCGATGTGCCGCATTTTCCCGGTCGAGCTCTTCATCCCTGCCGAG
AGCCGGGCCGAACTGATCGCACGCCACACGGCGTCGTCCACGCTGGCGCGCGCGGCGCGCACGAACCGCTCGATGCCCCACTTTTCGTTTGACTTTGAAT
CGATTTCGTCGGATACGCGTCGGAATCGCGTCATGTCGGTCGCGACCAATGTGAAACACATCGGCAACGGCGCGTTTGATCGATGGCTCAACGACGCGCG
ATCGCAAGGCGAACATTGGCGCAACATCATCGAAGGCGTTCTGGACGTTCATGAACGTCCGGAGCTCGTTTGGCGCGACGCCATGCAGGCCGAGCTCCGA
GAAGCCCTGAACTCGGAGATCGACCACCTGGAGATGACGCGAAGGCAGCTGGACACGACGTCGGGGACCGTTTTGCGATGGGACCACGAAATGTTCTACG
TCAATTACCAGTCGTACGACGCCGAGCTGATCGTGAACGGGTACTTTATTGAGTGTCTGATCCCAAAGTTGAACAACATGGCCGACTCCTTCGAGGTGTC
CGACCCCGTGGTGCTCGCGTGGCATTTGTCTGATCGCTTGTCCGTCGAGACCAACCAGCGATGGCGCATCCAGTGCGTGCGGTGCCTCCGTTTGATTCTG
CGGCGATACGCAATGACTTTCCACGGCCAACTTCCTGTCCACAACGTCTTGTCGGCGCTCTCCAACCACGCGAATGAGTCGCCGGTGTTCCTGCGAGAGG
TCTTCCAGCTGCTCAACACTGCGATCGTTACAACGCGCAATGCGCCATCCGACAACTTCAACCGCTTGAGCACGACGCTGGTGCGCGCTGTCGTTGACGT
GCTTTCCGACCCAGTCTTCGTCGCCAACTTGTCTGCTAACCACGAGAGCGGGTCGGATACAGAGGATGAGGAGAGCGGTGAAGAGGACGACGCAGACTCG
GAGGAGGCACAAATCTTCGTGAAGAATGCGAATGATGCGGTCGTGCGAACCGGCATCACGGTGCTACTCTCTATCACGACTCGTTCCAAGTTCACGCTGC
TTCTCGTGCGTCCCAAGCGCATGTTTATCTGCCGGCTGCTTGCGCTGGAGACGTTGGACCATGTGACAATCTCGAGGATCCTAGTGCTGCTCAAGAAGGT
CTCGGCACTGGACGAAAGCCGCACGAGTTCGTTCTCAATGCCCAGCAAGCACAATTCGAGTGCATTGAAGTTACCCGTTGATGGCAACTGGAAATCGTTG
GCGCTGGTCTACGTGCTATTTGCGAGCTGCGATCCCAAGGGGATGGGCATGTGCATCGCTGCAGCCGAGTTCCTGAAAGAGAACTTTGCGACTTTGAGCT
CGAATTCAGCATCGTGTCCAATAGCGAATGGCAATGGCTCGACGACGACGACGTCCTCAGCGAAACCGCACACGAATGCGTCGTCTGAGTTTTCTCGACT
GTTGACTGAGGCGATGGGGTTCGCAGGACGCGGAATGGGCCGACTCTTGGAGACGTCAACGCCGCAAAACTTCAGCGAGATCTTCAACGCGCACGAGAAA
CGAGCAGCAGATGTCAATTGGGGTCGGCGACATCGTCTGCGTCTGTATCGATACTTGAAGTCCAAGTACATCGCCTCGACCGAGCAGCAGAGTGCGAGCC
ACAATAAGGAACACTACTCAACTTACCCGATCGAGCTGATTGATGGCGATCATTTCGCAGACGAGGAGGACATTTTTGTGGGGAACATCTTCTTGCGGTC
GTACATTGAAGGCGACGGCGAATTTTTGACCGAATGGACACCCGAGATGTACGGAGAACTGATCGGCGCGCTGTTCACACGACTGTCGGACCTTGGACGC
GCCAAATCTGTCAGTGCAGAGAATGAGGTCAACGTCGTCGGTCCAAGTTCACTGCGCGGGTTGTACGCCGAGCCGTGGGAGGTGCAAGTGCTGATCCTGA
AGGCGCTGGCGCGCTTAATCCCGTCGCGATGCACAGACTTGGAAATCAAGTCCGACTACTATGAGGCATTGTTGGCCCCCATGAAGCGCACGCTGCTCGG
GGAAGCCGACCAGATTCGAGGAATCTTGGCACTGGAGATCGTGCTTGCGATTCTGTCGAGTCCAAGCGGCAAGGACGTCACCAATGCTAACATCGCGACT
TGCATCAACTTCCTGGATGAAAAGGGACTGGCGGTATTGGGTGAAGCACTGGAGAGGATGTTGCACCCGTCGTACCAAGAACTCCTCAAATCGGTTAGCC
GCGGGATCCACAACATGGCGCGAGTGTTGCTGTATCGAGTCACCGACGCCATTGGCGCGTTGGCGCTTCTCTCGTCTGGCGTAGTCGCGATCAAGCGTAA
CCCGAGCGTTGTGACGGCGCTGCTTGAGCTCTCATCGCGGCAAACCATTATGAAGTACTCGGAAGACGCGGCAACAGTTTGCCTGAGTTGCCTGTCAAAC
CTTTGCCACTCGGACGAGCTCCGGTCGCTCATTGTTGGTGCTGGTGGGCTGCTTTTCCTGCTGAACACATGCGCTTTCTGTCCAGCAGAGGAGACCATCC
AATCAGCAGGTTCGAGTCGGCTGGGAAATCAGGACGCGGATGCACGTGGCGAGACGACGGAGCCCAAGGCGTCGCGGTTTATTGGCGCTGTTCGGAGCGC
GGCACTGGCCCTTCGCTCTTGTCTGGAGTCGGACGATACTTCGCTTGCGTACCAAGTGCTCAAGCAGCTGTTGACGCCGAGTTTCATTCGGGTGAGCCAG
TTGCTTCCGTGTGCTATGTGTTCTCTGGTTGCTGGTCGTTGATTGACCGTCATCGGTGCTGGCGATGCTATGCAGATTCTGCGATCGTCCCCCGATCGGT
TTATCCTGTTGCTGCAGAGCACAGAAGACATTGAAACAGCAACCCTCATCTGGAAGAGAAGGTAATCGTCGCCATTCATTTTGATCGTTTATCATTTGGT
GACTGACTAATGCTGACTGATTGCACGATTCGGTTTCTGCGAACAGCATGCAGACCCGATTGAAGGACTGTCTGACGACTGAGCTGACCAAAGTCAAGAC
TGCGGCGCGGTCGAAGATCTGGCCGCGTTGGAACCCGGAGCATTTTGTGGCTGCGGACTCGTTCCGTTACCAGTACCCCGAGCTTGCGGACGAGCTCATT
CTGCAGGACGTGTATTTGAACAATTTCCTGCTCGCCGACGAGGACGCCGGGCTGGAAGACATTGACATGTCGGCATTGTCGGAGGCGCTGCTCATCTCGA
TCCAGAGCAACGAGAACGTGCTCCGCATCTTGGAAGAGGTATATTCGCCGCAGGTCAGTTTGTGGTTGCAGAGGATATTGCTAACAACGTGGCGACTGTT
TGGCAACAGCGAGGAGCGAGTGATCCGTCAAAAGAAGCGGCGGTGCGGACGATGCGCCAGGCTCTGAACAAGCTCGTGAGCACCCATCCTCAGCACAACC
TGGAGGTGGA