Description :
From Genome Similarity Track
Location :
Scaffold_497:100- 7035
Transcript NameFunction/comments
g4232.t1hypothetical protein

Sequence
6935 bases(100 bases per row)
TTTTCCGAAATGGACTGAGGTGGATTGGCGGTAAGCTGAGCGGACGAAGATCGAGATGCGTTTCTTGGCTCTGCAGAAGCGTATCTGCTTCGGTTGTCGC
GGTCACGCCGATCATCTCCGCGGTACCGGCTACCCTGTCGATTTGTGTCGTCATCCCTTCGACTGCCTCGCTCTCGATTAAATGAGCCATTGTAGTCGTG
AGATCTACTGGGCTCATTACGCCGGACCTCTGTTCTAAAGGAATCGGCGTGCTCACTCCTACGATGCTCAGAAGCTCTGTCGTGTGAACGGCGTTCTTCC
CGCCGGCGTGGATTCGCTGTAGATGGATTGCTTCGGTCCCGAAAGCTTCTGATCTCGTGCTGACCTTGCAAGTCCGATAGAGTAGGTGTCGTTGTCACAG
ACGTACGGGGCTTCTTGGGAACTCCTGCGCCCGAAGCCTCCTCCGCAGGTCTTTTGTGGCTATCAGCAAGTTGGTTCACTACTTGATCACTTTCACTTTG
ATCTCGAGAAGTCTCCGGCCGTGATTCAGATTTTATGGAGTCTGAGGATGACTTGGCAGGGGTCTTGTGATCGTCTTGAAGTGCACTACGTGTTCCATCA
CTGCTTGTCTCCTCCTTCACGCTCCTACCTCCTTCCGCAGAGTTTACATCTGCTTTGGAAACCTCAGTGGACTTCCTTTCATTTTTTGCCTTTGCCTGCT
TCGCAGTGGGAGTAGATCTCAGAGATGCTTTTTCGTGCATCATCTTGTAGTGTTCAGCCAAATCACGGTATCTGTCGCTTTCTAGCCGCTTGGCCACAGT
TGGAAATGGCTCTCCCTCGGTACGAATGATCAGCTTACGATCACGAGCACTCTTAACAAGAGCCGCCCAGGTTTCATCGCGTACCAATGTGTTGACATTG
CCAATCACGTACAAGCAGAACCGCGCGCGGGTGATTGCCACGTTCAGTCGTCGGATATCGCGCAAGAAACCAATACCTCCGCGGCGAGAGGATCGAACGC
ACGAAAATACAATCACGTCTTTTTCTCGACCTTGGAATCCGTCGACCGTGTTCACTTCGATGGATACGCTCGCCGGGATCCCCGAGCGCGTGATTTCCTG
CCGAAGTACACGCACTTGTTCTTTGTAAGGAGACACGAATCCGACGCTCCATTTGTTGTTGCGCACATCTGCGCAGGACTCGAACATATTCTGGCACAAG
CTGACGCAAAAGGCTGCCTCGACGCGATTGTACTTTGATCCGTTCATGTCTTCCTCCCTCGAGTTGTCAACATCATACAGCAGGAAGGGCTGGAAGCTTG
TCCGTGCATATACGCCGGGGCATACCTTCTGAACACGCTCCATAACGCTGGGTCCATCGGTCAGCATTCCTCCGTAAAACCTTTTAGATGGGAAGTCGCG
CAGGAACGGGTGCATTCGATATTGCACGCGAAGCATTGACGGTGCAACCCCACTTTGTGCTATCCGTTCGAACAGCGAGCGATCGTACCGAGCATTAGCC
GCGACGACGCTTTTTACCGTAGCAGGTAGCTGTTTCGGATCACCAACCAACACAACTCGAGCGACTCGCTCCCGAATCGGAACAAGGGTGCTTAACTCCA
CTGCTTGAGCTGCTTCATCGATAATGAGGGCGTCAAATCCGCGCTTCAACTCCGAGAAATCGCCACTTCCGGCCTTTGACAATGTACAAGCAATGATGCT
TGCCTTGGATAAAATGGTTTCCGTCATTTTGCCCCGAATCGCGGTCACTTCATCTCGCAAGCGTCGAATCTTACCTGAGCACCCCGTCAGCTGTTGATGC
ATCTTAGCTAGCGCCTTTCGATCCTTTTTAGGGCCATTGGGGTCTTCTTCTTTGTTGTGGAAATCACGGATAGAGCTGCGCAACTGTCGTTGTGTGTCTT
GGAGTGAGTGCAGTTCAATTGCTTTGGGGTGGATTGCCATTTCGCGCCTGATGATGTGAGGCAAGCAAACCGAGTTTACGGTCTCGGGCGCGTCCTCTCC
AGCATTTCCCAGGCGCACGATCGAAATCCACTCCTCTGACATGGCCTCCGGATGCACACTTGGCGCTCGGACTTTCGTGACTGTTCCCGAGCTGTCCATC
AGCCCATCTGTAACAATTCGCAACACCAGCTCATTTACTGCACCGTTAGATGGCGCGCAAAGCAAAATGTTGTTCATTCTGCTTGCTGATCGCTCTGATG
CTGCTCTTGAAATTACACGGCGTTTCACTACCAGGTTCGACCCGGCTTGATGTCCTGTCCGAGATGACAGCTTGTTTTCCAGTCGAGAGCGCGATGAACC
CGCATTCTTCAGTGATTGAATAGTTGTTCGACTTGGAGCAGCTGAAGCAGAGTCGGAGGAACGACGAAGAATACTACCAAGTGCAGAAGTAACCCCACTT
AACGAGAATGCTGGTTCCACATCACTGCGAGATGCTTGTCCACTGATTTGTCCAGCATTCACACCTCGAGACCGTGCAGCCTCAAAGTTGTTGAAGCCCC
CCTTAGCTCCGTTCGCTTGAGCATTTGGACTGTTTTTCGGGCTCGCTATCGGCATCACCGCTGAAACTGGTAGCCTCAATGATAATAGCCCACTGAGGAG
GCCCATGATCGTTTTCGTTTTGCCCGTTCCCGGAGGCCCCTGGAGCAAAGACACACCCATGCTGTAGTTATTCAGCACGCTGTGGATAGACTGAAGCTGG
GACGAGTTGTACTGAGGCTTAATTGCCTCCCACAGCTCGGGTGATAAAAATCGCGGTGGGCGCTCCAGGGTGTCTTTTTTATCCATGAGGCTTGTCCATT
TCTCCTTTAACTTCGCGGACAAGGCCTTGACTTCTGAATCCTCGTGCTTGCGCAGCTTGTTCACAGCTTTCCCTATACTTGTAGACTGAGGAGAAAGAGT
TAGTATATCGTCACCAAAGTAGCTTCACAACAAGCAAGGCGCACCCTTAAATCTGTAAGCATCACGTCCATCTTGTCCAGGCGTTTCAGGAGCTTCACAA
TTTTTGCATATCCTTCACTTGATTTATCTGCTCGCAACTCGTCCAGCACCGACGTGATGAGAATGAGCTCCGATTGGGTGGACTTGTACGTGTCAGGAGT
CAGAATGGCTGTTCGCAAATGCTCAGGGAGCATATCAACAGACCGAAGCGCGATGTATTCACGCGCAGACGTGACCAAGTTACAAAGTGGGTTCACCTTC
CACTCCGAATCCGCGATTACACTTGCTGCCAACACTTCTGTTGAAAAGGACTGCACACTCGCAGTAGCGGTGTCCAGCTCGCCATCGTTCAGAAAGAGTA
CCTTTACGGATTCTTCCTCTTCATTCTTGCTGCTCTTCTTTGCCGACGATGTTTGCCTTCGCCCCTTCTCCATCTCGCTGATCAAAATGACCCCCACAAA
TTCTCGTTTCCCCATGAAACCAGCCTGGCTTTGGCTACCACCAGCAATCTGCAACAGCACCACATCTCCATTCCGGAAGAGCTTTTCGTTGAACCATCTT
CCTGCTCGGCCCTTTCCCCCAAACTTTGACTGGGAGCTCGCAAGCAACCCCTCATCTCTCTGAACGATGCTGAAGCTAATGCACCGCATTCCTTCTCGTG
GTTTTTCTGCTTCGTAGCGCAGCAGATGACCTCCGTTGCTGTAAGCACGTTTTCGAAGCCCCTCTTGAACTTCATTGTTGCATTCCTCCAGCATCAGTGG
CAGGAACGCACGGACGTAGTCAGCATTTTTCTTGAAATTCAAGCCGGGTGCTTGTAACTCTTTGTCGGATCGTTCGTTTTGGTACTCACCAGACAGAAGA
ACAGGCATACATACTTGTAGCAACTGCCGGTAAAATGGTAACAGTGAGCAGACAGCGATCGGCTTTCGAGTCGTCTTGATCCGATGAAAGAGTGCAGCAA
AGCGCAAATCTGTATCCTCTTCAACCTCCTCTTCCTCCTCTTCAGGTTGTTTCGCTGCACTTTCATTGACCTGTCGCTCCACTCGGATAGTTCTGTTCGA
GCCTGGGTGTGAGTGTGATATTCCCTTAATGACTTGAGTCATGTCGAACGCCGCCTTCGACTTTGGTGTGAGCCCCTTGGGAGAAGGTTCACGCATGGGG
GGTGCACGGTACTCTTCTTCGGAGTAGAAGCTGTGGTGCTTACGAGCTGCTGCTTCATTCGATACTTCCTCGACTCCAGTAAGATCCACGACTGCATGGG
CTTGAGCTCTTGCAGCAGATTTTCCGCTCATTGGGCGAGCAGTAGAATTAAACAAGCCTGCCGGTGCTTTCGTCCTCGGCGGCAACCTTGACTTTGACCT
AGAAGTCAAGTCCACAAAGCTCTGCATACCACTTGATCCTGTCGAGCGCTTCGTGAAAAACGACGACGTATGGTCCAGCTGCCGGAACTTCTTGGTCATG
CGCCCAAAGTCAGTAGACTGCTTGGACTCAATGGACGCTGCCTCACCCTTGATGCTGTCGATCATAGAAAGAGTGGCTTCATTTAGGCGAGTATTTCCCT
TCAGAAGGCACCCTAAGACTGTCATCAACAGTTCTGCTGCGCGCTTGTTTTCAGACGCGGACCCCCTTGCGATGCATTCGACCAGTGGGACAATGAGCGC
TGCTACTCGTTTGCTTGAGACGCTTGGGTCTTTCAGTACGGACACCCAGAATTTCCAGAAGGAGATTCCAAAGTCGAGACACTGTACGCGAGTCGCTTCG
GTGACCTCCACGGTACATTTCAGCTTTGGGTCAAATAAGCTAGTCAGGAGAGAGATCAAAAAGTCATTGATCAGACTGGGGAGTTTTAGCAGGTGTGCAG
CTGCGACGCCAGTGTCTGTGACCTGGTGGGACGATGTGGCCTCGGCTTTTGCATTCGACGCTTTCTGGAAAGCCTTTTCCAGCTCGCCGCCCAGCATTTG
AAATACGCGGGACCACACAAACACAAGCTTCTTTACGGCAGGCAAACAAACAGCTGGTGAAAAGCCGTAGAGCCGCATTGACTGAAGCATCGAAAGCTGT
CCACGCAAAAACGCCTCAGCATTTCGGTGAACAGAAATGATAAGGGCCTCCAGCGGGGAGGGAACTTGTGTTGGTCGCTTTTTGTCAGCGGCGTATTGCC
CAATTAACCTACAAGGAACATGAAATTTGAATCGTTAGCATTTTGCACTCTGAGGCACCATGTCAGTCGCGTCGTGCAAATCCGTATTTTATAGCTTCGA
GAGCACAATGGACGAACCTTTTGATCTGTTGATCAACGCTGCTTGTTGGACTGAGGTAACAAGCACTAATGTGTTGCGACACAACAGGAAAGCCAAACGG
GTTGCCTAGGCCTTTGACAAGCACTTCATCACACATGCGCTGGAGATACTGCTCCGTTTGTGTTTCGTAGCTCCGCAAGGTTTCAGAGAAGTGTTGAAGC
TGCTCACTGGGATTGATTTGAGCAGCAACACAATTTAACAGCTCTGAAATGCCTCCAATCGACTCAAATAGGGCTCCATGCACTTGAAGCGGTATTGTCG
TAATCGCATCCCAGGAGCATAGTTTCTTCAACAATTGCGTAATGATTGGTTTTCCCTTCGTAACGGCTTCAATCGATGTGGCACCTTCGCCTTTGCTCAC
CGCTACATCCGTATAAATGACGTCACGAGCAAGCTGCAAGTGTTTGCTCAATACAAGTGCTGTCGTCTCCGCTGCCACGTCAACGAGCGATTCGATATTG
TTGGGCCTAACAACAATGTCAAATAAGTGATTCATCCACAACTGCCCCAGATTATCGTTGGCGTCGTCATTACACGGCCACCAAAACGCGCTTTCCGAAA
CAGAATAGTCGACCGAGATCGATTCTGATAGCGCTCCTTCATCTCGGCCTGCTCCACCCTGGATGCTTTTCACAGAAGGCATGCGGTGCTCATAACAGTC
ACTTAAAATTGTAAACGCAGCCCTAGACGACGAAACAATAGCGACTGCATCAAAATGCTTCTTGCGGAAATCTTCGGTAATCAAAAATCGCAAAATTTCC
GTGCGCGTTTTCAAGTAAAAATCCAGCTTTTCTTGGTGGGACTGGTGACAAATGTGAGTCAGTTTTTAGTGTCCGAACCACAAAATGCAAATTAACAATA
ACATACCGCAATACTGGAAACTTGAGGTGGTCGCATAGCCACAAGTAGCGCTGGTAAAAGTTCAACAAACTGTTTCGTCACATATACACGCCAAGATGCT
AAGCAGCAATGCTGCATCACCAAATCCAGCACCACTTTGGGGGAGTTGACACAATAATTCCAAAATCGGTGTCCAAGGCAGCGCAAAAGAACGGCGAAGC
ACTTAGAAACCTGCAAGCAAGAGATGTGGACGGCATAATTAATAGAAGTTAAGCATAGCTCCAAGGTACCGACCTCCTACCACCAATGTTACTGTTTGGT
CTCCAGCAGGGTCTGCTTCCTGCAGATAGTTGAAAACAAGATCCGGAATCGTGTCAAACGAATCAAGCAATGCTTCAAGACTGTTTACGTCCATTTGCTA
TACACAGAACAAATCCAAACACCCAGTTAATGTATGATGCATTTCCGCCCGGTATTTGGTATCGTGTCTCACCTGCATGACGTGATCAAGTGCCGACCAT
AGCATCTGCCTGGTCGGTGTCTTCACGCAATTTGTCGGCTCCAAAAACTGTGTCAAAACCCGTAAACTTCGGTGAGACTTGCAGTGCACTTACAACCGAA
TCCAAGACCGTGATGAAACTCACGTTTTGAAGGTCTTCTGTCGATCTCAAGTCCAGCGATAGCACAGATTTGTTGAACGCTTGGTTTTCCAAAATGTACA
TCCACTCTTCTAGCACATCGAGAAAATACTGGTCTTCACCGTTATCCCCAGTTAGCTGGATGTTACCAAAGTGTTTCACCATGCGTTTAGCCCATTCTCT
ACAGGTGCAACCACCATCAGTTAGATGTATGCTAC