Description :
From Genome Similarity Track
Location :
Scaffold_1147:100- 3146
Sequence
3046 bases(100 bases per row)
ACCGTTAGCTTGTGGTCGGTAACTCAGCGTAGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAGCACTTCACTCATAAACCTTGGATCTCGG
TCGTGCCGTATCAGAGACGGAGCCCCGAACTGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGA
TAACGAACCCCGTGAAGTGGTCCTGGAACAGCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTCGAA
TGGATGGTCTGACACCACATTTCCCGGCGAATAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACG
TCGGCGTAAAGACCAATCCAGTAGTAGTCAGCTTTGACTCGGTGATACGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGTAGTTATGAA
GTATTTCGTCGACCATGGTTGACGGAATCACCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTATAACAG
GCCGTCTTCGTTGAGTACAAAGACTTCTGCGACTTTGCCGGCATTCTGAGCTCGATGGTGTGTAAGGTCCTCCAATTCACCTCTCAGGTACGCCTTCAGA
TCGGCCCACCTGAGTTCTTCATCTTGTGCCTTCGCGATTCGTCGTCTCCGCTCAGTCTGCACCGTCACTGGATCAATGTCGTTGGCATTCTGAGCTGTCT
GGGCTGACTCCATCTGCGACCCTGTTTCGACATTCGGGGTCGTGTGGTTAATCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCT
TTCAAACGCGGATTCTCCAGGATTGGTAGACATGGCTTCATGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGA
ACTCGGCGTACTCGGCTACGAGTGACTGCCGTGACAATCGGTGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGCTACGCGGTTAATCATTCTCA
GCTCTGCTTTCCTATCCGTCCCAAGAATTACTCGTCCGGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTAT
GTGTCGATACCGGACCGAGTTGAGTTGTTTCGTGAGATCCTTGTGCCGGGCTAGTTCCACTTGCAACGTGTCCTTCTTGCATGCTATCACCCCCATGGAT
TGCTGGATTGCAAGCCGGGAGTCACCCACGATAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGA
TGTTGACTGTGGTGGACGACAGGTACGCACTCGCAGCAATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTGCCATACCCGCCGTA
CTTAGTTGTCTTCGCTGAGCCATCAAATGACAGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGTCCATTCGAACTGTCGCC
GAGTTCTTGGAGGGAGGTGCCAGGTGCTTCAAGGAATCGTCGAGTCCGATGAACGGGGTTATCGACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGCT
CACGTACTCGTTTCACCTTCAAATCGTAGGGCGACAACATAACTGCGAAACTGACTGCGCGACCGTACAGCGACTTTGACTTAAACACCCACTCCAGCGT
GGAGAAACGGGTGTAGACGTGAAGTGTCTTTCGCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGTAACAGCGCGACTACTTCTTTCTCAGCGGGATGA
TAGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATGTACTGCTCAGTGCCCACTCAT
TGGCGTACAACATGATATGGACTTCTTTCGCCGAATCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTCGAGCTCGGCGAATGACGCTTTTGC
TGACGCCAAGTCACCCCCAGGGCCAAAGTCCGTATCTTTGAGCTGATAGAGTACTGCTCCGTAAACAGCAAAGTTCTGGATGAATCGGCCGTAATAGTTG
AGGGCACCGAGGAAAGCTTGCATCCCCTTCTTTGATTTCGGGAAGGCGATCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCG
TAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGACAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAGTCGGTC
GAGTGTCTCCAAGCAGGCGTCGAGCGTCTCCCCTCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCCAGGAAGACTGGTCTGGG
TTCTCCGTTAGCAAACATGTCGCCGTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAATTTCGTCAGC
TGACGCTTCGTTGAATCACTGACTCCGCCGAGCTCGACTCGCCGAGTTCCCGACTCGGCTTCAGCAATAGTCATCCGTTCGGCAAACAGCTGCCATCCTC
CCTTTGGTTGAGCGTATCCCCATAGAGCGTTGTCGATCAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAACGGCATTCGTAACCATTCAAAGTG
TCCAAGTGCACAGACGAACGCTGAGATCTGCCGAACTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAA
CTCTCCTATTCGGTAAGCAGGTCATCAACCAGTAGCATAGCGTATTCCATCGGCGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAATAT
CCACACCATTTTTCGTGAGCACTATCACCACTGGCGAGGCCCAAGG