Description :
From Genome Similarity Track
Location :
Scaffold_2286:100- 2606
Sequence
2506 bases(100 bases per row)
GCCCGTCTGTGCAAGAAGCCGCTGGCTTCTGACGAGCCAATACTTCCGGGTCATCGCCGGGAAACGAGCATTTCCCAGTAGGCGCGGCGCGGCATACTGG
GGAAGAAGTGAGTTCTGTTGTACCTCGAGGAGGTAGAGGGCAATGGGGCTCAGCCCCGAAGAGAGCTGGGCTCTCTTACGAAAAGAGTGTGTGCAAGCCG
GGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAACCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCC
TGGAAGGGAGTCAGCTGTATGCTGAAGCACTAGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGT
CTCTGTCGACCTTGGAGTGAAGCTTGAGAACTTCGATAGCGTGGAACGCTGTTTAGTCTTAGACCTGGATGCGAGGTATGACATCATCCTTGGCATGGCA
TGGCTGGACGCATGAACATGATCGACTGGAGTCGAAACGCTGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAG
GGAAGCAGAAGCGCTTTTGCGCGAGCACGAGGCGAGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCTGAG
GGCGTACGTGGTGCGGCACGTTATTCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATC
CACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGC
AGGTGAAGTGACACCTAGTTTACTGTGTGAAGGTCAAGAATCCCTTGCCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTTGAGGAGTGATGGT
GCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGGAGAAGACGCAGGGCGTCTG
TGACGTCTTCGACGTCGGACGATGTGTCCAACGTGTCGAGCGGTGATGCTCCACGTGATTGCTGTGAGCAGCTGTATACACTCGTTAACGGAGTGACGGG
GGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCAGATGCTCTGCTAGGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAAGG
CAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGCTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCT
GAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGACCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACG
GGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGATCGTGGAACCAAATACTGCGTAACAAGGCAATAGCCTTTGCCGAGAGAGCAGTGTG
ACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGCGAGAGTAAGTCTCCGCACTCGACACCCTCGTTCTGTGTCAGAAAGCCGAA
CAGCAAGTAGCGCATTGTTCATACTTTTAACAAGCTAAATACGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATG
GTAGGCTGTATGTGTACAGCGCGCTCGACTTGGTCATTGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAG
CGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAGCGCTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCG
TACGCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGCCGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCG
AGTGCATGCCCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTT
ACGGGCAGATCCTGCCAAAGTCAAGGGCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCAC
AAGTACAGCGCGAGCTACGCGGAGATGACTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTG
AGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGCTTAGCGTCGTCTGTGACGCCTCCGAATTTGCAATCGG
TTGTGC