Description :
From Genome Similarity Track
Location :
Scaffold_2977:100- 2531
Sequence
2431 bases(100 bases per row)
TCCTCTAGCGCAAGGTGGCTGTGTGACCCCGTCACACTTGGGTAGCACTTGAAGTCAAATCCCACGGCAACCCGCGGGTAGACTACCTGAACCTATTCCG
AAAGTTCGTTGCCATTGGACAGGAAACGACTTCTTCCCATATGAACGACTCTCAGTTTCGACTCGGTTCGGAAGATGGCAGGGCATCTTCGGGGATGGAG
GCCCTTGTAGAGCCTGGTGGCGTCAACACCGGGCCGAGCAGCTCGAGGCGCGTCAAATGCGTTTGACGCGTACGAGCAGGGCCTCATCGCGCAGAGCCTG
GTGGCTCCGGCGGCGGAAGCAATTCCACCTCACCCGAAGCCAATACGACTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTCGG
TCCGAGAAGTAGAGCACGCGATGGACGTGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGCGTTG
GGTCTATACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTAC
CACCAGCGTTCGCGCTTCCTCTCGTGCAAACAAGTAAGGCGTGAACTGCACGAGTACGTGTAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAGCC
CACTCAGCGAACACATCAAGATGACTGTGTTTATGAACGGCCTTCGAGTGGGTCCCGCACGCACTCAGCTGTTCCGGGTGTAGTCAAACACCCTTGAAGA
GGCGATTCAAGTGGCCCTTCAGGAAGAGTACCGCCATCACCAGGCGCGTACGCGGACCTCAGCGTGGCCTGGGAGCTCCATGTCGACCCCCGGTCGAACG
AGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCTGCCAAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGACCACTTCAAGCGCGACTGTC
CCGCGGAAAGACTCCGCAGACGGTCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAATGCCGGAAACCAATA
GGGGCCGGGCCGCCTACTGGGGAAGAACTTAAGTCTTCGTGATGGTGCGCGGTGGCGCGTACCACGAGGATTTAGACCCTGAGAGTCTTCGCACTCTCGA
ATCGGCGAAGAAGCAGCGGCGGGTTGCTCGTAGTACACGGTCGTGTACGGAGATACGATCCCATCCCTTAGAATCTTGATCGATTCCGGGGCATCGAAGA
ATTTCGCACGCCGCCAGACAATTGCTCGTAATAGCAACAAGTTGTCCGATGCCTCGAAAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGA
CGAGAAGGTCGTCACTGTCCCCAATGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCA
TATGATATGATCATGGGCATGCCCTGGCTTGAGAAGCACAAGCCCTGGATCGACTGGCGAGGCAAGGAAATCGGTGCCAGCCGCCCTACGCAGTCCGACA
GAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGTCTGACAGGGTACCAAAGCATTCGGCAGATGCTTGGGAGTCGTCGA
CGTATATGACGACTCCGAGGATGTTTTTATGGTGGCAGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACTTAGGTTCAAAAGCGGGTAACTTAGTTCCG
CAGACAGCTGCAGCTGTCACGAACACCAAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACACACGGTCGCCCAGACCTTAACTGTAGAGGAAGACG
TCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGATAAAGGCGTCGAACACGCTTCTTGTGTGGGTACCAT
AGTACCACACGAGGCCACGAGTGCCTCGGATGTCGCAGCGCCGACATCCCCAGACGTGGGCAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGC
CGCCGCCGCCTCAAGTCGGATCCGAACCTCGTTCGGATCGACGTCGCTTCAAGCGACTTGGAGTCCAGGGCCCGGGCTCCTCCGACAAGCCGGTGGAAGA
GTGCTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTTCATTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAG
GAAATGACGGTCGAGTCTTTCCTGGCCAGCCGCAAGGCTGGAAAGGTTGCGGAGATGTTGCTCATGAGACCTGCGACCACTCGGGAGGAGCTGAACCCCT
CCTCTGTCTTGGACGAGTACGTCCTGGAAGA