Description :
From Genome Similarity Track
Location :
Scaffold_870:100- 1319
Sequence
1219 bases(100 bases per row)
CTTTGACCAACTTCAGCTTGGATAACGTGTACTACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCTATCTTTCGCT
CACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTGTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGG
TGCGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCTGCAGCCGTTTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACT
TGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGTCGCTTCTAGGGTGGATTTGGGATCTCACCTATGTACCAAAA
AAATGGGGTATCACCCTGGATCCTGTCTTGGGCAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACAGCTTGAGTG
CCCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCCCGCTGTCTCTGCCCTAGGATCCGGTTGAAAGC
TCGAAAGAAATCAGATATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTTGGCAATG
GTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCA
ACGGGGGAATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTT
ACAATCCACACATTCACCGACATAACGTTGTACGCTCTTAAATAGTCCCCTCCAATGGAAACATTCCCGGATCCGTTGGTAGGTCTGACCAATACCCTGA
TGTCCACCTTCTAAACTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTC
TCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTATAGGATTTGGTATCCTCCCGACTCAGGTCTCG
TACATCCCACATCAGATAC