Description :
From Genome Similarity Track
Location :
Scaffold_229:10- 4672
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19897hypothetical protein
Phypa_INRA-310PPTG_19898hypothetical protein

Sequence
4662 bases(100 bases per row)
AACGCGTTCTATTTGATATTCACCTAGGTTTGCACCAATTCATTTTATTCCACATGCCCAACAGTGCTCATTACCCAGCGTTAGCTGGATTATCAAGAGA
AGAGTTCACGGCTAAAATGCTCAGCACACTACTCTACAGTTTCTTTGAGCTCGGGTCATTCGTCATGATGGTCATCGTACTAAAACGCAGACTTGGATAT
TCCGGTTTGCAGCAGCTAGCCTTTGTTCTAGACGTGTACGCCAGTGTGGTTCAGACGAAGCTGAACTTGATTTTCGTCTACATCATGCAAGTGTCGTTGG
ATCACCACGGTGAGTGCATTTGTGCATTTGGAAGATCTATCGCGAGAGAGACTAACATGTGTTTCTTTTTGACTACGGTAAGGTGCTGATTTCACATTTA
AATTCGCGTGGTTAAACTCGAAGAGAAAGTTCTGATATTTTGAATAATACACATGGGAAACGCAACTTAAACACATTAAGCAAGCTGGTGTTTACTGTCG
AATGTAAACAAGAGGCAGAATCCGCAGAACCGACCGTGTACGTAGCCAAAATCGGTGCGAATTCGTATCTAAAACGTCGATCCGTTTTTTTAATGACTTG
ATCGGTGTGTTGTAAACAGTTGTAAATTTTTGAATTTCGGGCGTTTAAATTAAATGTACACTATTAATACAGATAATAGATGCTCTGCACACGCCCTTAA
AGATCAATACTAAGTGTCATGTCGACACCTCAGGGAAATAGAGAATTCCACTGTACGGATATGGGTTTATAATCATCGAAGTGTCGTAGCCCTGTACAGT
GTCTACAAGACACCGCCACCAGACGAGTCACAGCGAGGCCAATGGTAAGTTCACCTACACCCTAAAAGGTAACTGTGATGAAAACTGCAATAGGGCGTAA
TTCAAGAAATCGATGCAAATTGATTTTTTTTTGCCCTTGCCTGACCGCAACAATGGATCTTGGAATGCCATCGATATAAGGTATCGCAGGATAACGACCT
CAAGTGCGAACAAATAGACAAAGTCGCCGCTAGAAAGCATGATTACAACGTACAAAGCGGATTACGGGCAATCAAGAGAACGCCACACAAGCGAAGTATC
ATTGTCATTTGATGAAGTTCCTTTCCAGTTGTTTTGTTGAACTTGAGAAAAGATGGACTTTCGGGTAGTAGACCCCACTAGATTTCCGCAGCCTCTCTAC
GATAGAGAGGCTGCGGAAATCGCTCCAAATGCTATGTACTATGTATACTGTAGATGCCTTTGTATAATCGCGAGTATATTAGCCGAGTATGGAGCTTTAC
TTTTTAGTGTATGATGCTATTCCAATTGTATATATATTTTTTTAAATACAATATGCATTCTTTTGTGCGTAACTCAGCAACCACTAATTACAACGTACTG
GTTTACTCCGGCTACAATGGTAATTATTTCATATTTGGAGCAAATCTAGTGTCCACTCTAAGCAAAGAAAAATGCAATTTTTGTTTTTTACAATTCGCAA
GTGGTTTGATGTAATGCTTACCTGTAAAGAGGGGGAGCACTAAAAAAAACTCGACAGATGACTTGTATGCGATGATTGTAAATATTGATATCCTGTCGTA
CTTGATAAATTGCAAACTGGTAGACATGCTTTTGTATAGTCCCTTGATAAAACTAACTTGAAACTTGATACCTAGCTACGGTGCAATGTGATGATATAAA
AAATATGGTCAAAATCAAAGGTTTACTTACCTACTAGCAGTTGGAATCAGTGGTACGTATCGACATGAAATCACGTGCTCGTCCATTCTAAGCCGATTCT
ATCGGTAATCAGGCAGTAGAAAACTTGGAGTACTTACTACCATAACTTTTGAATATTTCGTTCGAATCCCACTAAATTTCAGGAATGTGCACCACACCAA
CAGTCGTAACACGATCAACTTGCTATACTGGACGTCTGCCAATAATGCAGTAAGTACCCACCATATCGCAGCGGATAAGACAGGTTAAAAAGATACATAC
TAACTTATCGAGATTGACGTCTACCACAAACGCATTAAGAACTCAGTGTCTGTCCTTGGAAAACAGTCCCAGTTTGTGCTAGTTACTAGGGCAAATTTAA
TGTACCAGCCACTTCTATCTGGACAAAACGTGCCGTTGACTCTACCATTTTCTATCTTTGGGGCTCATTCGGTGTTTTGAGTGATTTTGGCGCAAGATGG
AGGACGGCGAAAACACTACAACGTCTCTGCTGCTATGCATGGGTGAGACACTTACGAAGTACGAGAGGGAAGTGGATGACGCTCGAGATGCAATGTTCCT
GTCTTATGACCAAGGAGGTATGGTGGATCGCTATGCGATCGCAGCACTATCTTACCGTGAGTTGCCTCGGCAAGCCCACCGAGTCAGCCTGGATATCCCT
GTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGTCTTATGACCAAGGAGGTATGGTGGATCGCTATGCGATCGCAGCACTATCTTACCGTGAGTTGCCTCGGCAAGCCCACCGAGTCAGCCTGGATGT
CCCTGTACATGTCACAAAACTTCTTGAACGCAACGCGTCTAACAAGGTAAGAACCTATCCTTAGCTTTATGAGTCCAAAACGAGGTGTTAACTGTCTATT
GGTACTGATGTAAAGCGTCCTTCTCCCGACTGCTTCACTGGTTGCACAATTCTACACCATTCCATCCCCTTCATCTAGGGGCCACCCACCCAAGCTTCGA
TATCTGCATCAAGTCCTGGGCCTCGTCATGTGTTATTACGTCGGGTCAATGGAGAACATCACGCTTAGCATGCTGTTCGGAGTACCACCGAGTGAACCCT
GCGGACGGCTGAGGAGGCGTTGGCAGCGACGTTGAGCGGATATGGGCCTGCTCGCATCGCGTGGCCGTCGCCGTCCCGACAAGTTGAGCTGGCCCGACTG
GTAGAACCCCGAGAGCCGCTGCTGAAGCACACTTTTGGATTTATCGACGGAACGAATCTTCGGGTGGGTACTTACGTTGGATAAGAAAATCTGTATTGTC
ATCTAATTTTTACACTTCTACTTCCAGGTGATGCAGCCATCCTACGCAGACCTTCAGAATGTCATGTACAACGGCTAGTTACACGCAGCCTTCGTCACGG
GGATAATCTGCTTTATCCAGAGCTGTTTCGAAATATGGCTTTGATAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN