Description :
From Genome Similarity Track
Location :
Scaffold_1493:10- 4420
Sequence
4410 bases(100 bases per row)
TTTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCTAAATAAAGCCACACCTGCGATCCCACTTG
GATTTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGGCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTA
TTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCA
TGTACCAAGTAGAACGGGGTATCACCTCGGATCCTATCTTGGGCGGTGTTCATCACGAAAGGGGGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCA
AATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCATCATGCGCTCGGCCGACCCATTAGCTTGGGAACGGTATGCCATGGTTGCTCGCTGTCT
CTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAACCTGGCTCTCGGTCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACG
CACTCCTCGTACGATTCGGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCAGTAAACAGGTCCACCCAAATCAACAATTCTG
TGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATGTGGAAAGGGTAAGTCGCTTGGATATCCAGGTGACTCCCCTTCGATTG
TGGGTCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGACAACATTCCCGGATCCGTTG
GTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACAAATCTCATCAAT
CCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGAATAGAAGAGCAAGTCTTTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGC
ATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGG
ACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACGTGGACTGTCCTTTTCCCGGATC
CCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCT
GGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGT
GTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTA
GTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAGCCTCCCATCCAGGTAG
TCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGG
TTCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCTTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTC
CCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGA
CTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGCTCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGT
ATCTCTTTCTCCACCGCTCCGTCGTTCACTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAG
CTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAG
TTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCT
CGGAGTGGATCCAGCTCCTGTGTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGATATCTCCAGGGCCAGAGCTTGTCGGATTT
TGATCCGGACAGCTGAAGTGGTCATCGCAGCAAAACCTACCTCTCTCAGTTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTA
GTAGTTCAAACTGACCAAGCAGGATTGCATCGCCCGTAGCGACCGTGGGAAGGACAAGTCTGCCAACGAAGACAGTTCCTTAGGATTCGCCTCCAACCCC
TCCTTGGAGACTCGATGACCTAGGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATTCCACTTAGTACACGCCTCCAGAA
GGGATGTCACTCTCTCGCACAACTGATCCACGATTCTGCCGGGATTAGAATGTCGTCAATATAAGATCTGCGTCCTAACACAGACGGGGTGCCAGGATCC
CCTGGCTCTCCCGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCGTTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCATTAT
CGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGCG
AGCTCGATCCGTCATAGTCACCACCCAGAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGATTAGG
GGCATCGGATACACCATCAATCGATTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATAATTACCACCG
GAGATGCCCACGGGGACGTTGAGAAATTGATGATCTTGGCTTGCAGCAGGTCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGGCACCTTTGA
GCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAAGGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCC
AGATGTTCTGACGTAACCGATCCACTTCCGTGGGTTCGTTCGCCCCTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGGACCTCCGGGATCACC
GCCAGGCCTTCTCCGAGATTTTCGGCGTGTAGATCCCCGCATTCATGGTAACAGACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGC
ACCGCGACCCTGTTTCACCTGACAGTCCTTCTGTCTTCGGGGGATCAGGTACCCTGATATCAGGGAAGCTCTAGCTAGTTTAAACCCGACGGTTCTGGTT
TGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTGCCCCATGCAAAACTAGGATCCATTCTGGGGTCAGCGGGATCTGGCGACCCGGCTTCAGC
TCTCTGCGATCCTTCATCCACCGACCCTGCGTTATCGAGGGGCCGACTCTGGGAATCATCCCCGGTCTTGAATCCAACCTCCATCGCTTGGACCTCCATC
CGACGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCCCGCCGGGAGCTCCACCTCTCCGAGAGATT
CGACCTCGGTAATCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGTGGTCCAGCTGACACATGTCCAGGTCGCCTAGGGATACCGGCCTTCGC
CAACCATCGTCCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCTCTGACGTTCGTGACCTGGAGGTATTGCGAACGACCTGGTCCCTGGATTACG
GTAGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGACCTGGCAGTTTCCAGGTTTCTCCGGGCTCAATCCAGG
TCGTCTTATC