Description :
From Genome Similarity Track
Location :
Scaffold_1225:10- 4340
Sequence
4330 bases(100 bases per row)
ATTCGGGTGAATCCATAGAGGGCTTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCACCCGGTTCCACTCGAACAGGCCAA
ACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATC
CAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACC
CCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTT
TTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCTGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAA
CGCATTACCTTTACCAATCAGCAGGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATC
ATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGTTCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTCACAG
ACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACCC
TGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATTGGGATCC
AGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCG
TTATCTAAGGGCCGACTCTGGGGATCGTCCCCTGTCCTGGATCCAACTTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAG
TTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATT
CTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCC
AGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCC
ACGGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTT
TGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACC
ATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAGATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCG
TTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATC
TAGTATAGACACCTCGGCACCACTATCTAGGAGTGGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACATTGGCTTGTCTGAACCACTTTCCTGGGGCA
TGGTACTTCCAGTATCCACTAGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATTCAGTGACCTGACAGACCTTAGGTTGAT
CTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATACCCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGA
GACTTCGGATCTGGCAAACTCATCCACTTGGTGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTC
CTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTT
TAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCG
ACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATC
CAGATTCAGTGTGCTTCCGGGATCCTCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTAC
TGTATCCCCCGGTCGAGAGTTGCCTCCTGTCTTCGCCGTTCGATCGTTGGATGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCA
TCGGATCCCGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACGCGTCGAGCTGGGGCCGTAGGTGTCGGAGCTTTTTTGGCGATACTTGCCAGAT
CCGACAGCCGCCTTCTTCTAGCGGTGTTTCGTGCGATCCACAGCCCGCAGCACTTCCTCAAGCTCATCTACGGCTGGAAGTCGTAACAGGGTCAGCCTGT
CGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATTCACGTGTTTCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACC
GGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTAC
TGGGTCTAAAAGCTGCGCAGCAAATCTGGCCACTTGTTTCTGGTGGGTCTGCCCAGCTGTCGATACCAGTTTCTGGCTGTCCCCGCTAGCAGATCCGCAA
AGGTCAGACACTTTTCAGCATCTGACGCTTGGTCTCTCATGAAGGCCGACTTGACTTTGCTGATCCATATTCGCGCTCAGTCTTCGTCTTGATCCTTGCC
CGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCTCCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAA
GTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGGAGCA
CTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGA
AGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTCGAGCCTGATTTGACGATAATCCCACTGGCTTCTTGCTGGATCTG
GCTCGATCCTGGATGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCCTCGGACACTCGCCCGCG
CTTCCAACATGGATGCCCCGGAGGGTCCTAAAGTCATGTGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGC
AGCTTGGCTGATCCTCGGCGATGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGATGGACTTAACTCTAGCAAAGAGGTCCCGCGTCGCGGATGCT
ATGAGATCCAGATCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCTGTAAGCAAACGTAATAGATCCTTGACTGCCACCA
ACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTC
GCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTC
TTCCGCGTAGTCTTACTCATCTTCGTCTTC