Description :
From Genome Similarity Track
Location :
Scaffold_2420:10- 3653
Transcript NameFunction/comments
Phypl_g15068hypothetical protein

Sequence
3643 bases(100 bases per row)
CATCTTCGGAAGCTGTACGAACTTCTGAAAGGGTTGTTGAAGGCTGGCCTGATCGCGTTCTCAGACAGCCCTTGGGCGTCGCCGATTGTGATCGTCCTCA
AGAAAAACGGCGTGGATATCCGTTTATGTATTGATTACAAGATGCTGAACGCGGTGACCGCGATCACGGAATACACTATGCCACTTGTGGATGATTTGTT
GACCGATATGGAGGCCTACCTGTGGTTCTGCTCCTTGGATGCAGCCAGCGCATTCTCGGCCATCATGATGACCATGAGAGCTCGGAAGGCGTGTGCGCAC
TGGGGCACTTCGAGTGGCTACGAGTGCCATTCGGGCTCAAGAATGCGCCGATGATTTATCAGCGGATGATCAACAACGCTCTGTGGGGTTGTGTCCAACC
GAAAGGcggatggctacacttctcggagctcatgcgggccgcggaggaggaagctAATGCTGCTAGTACAGGAGTGACCGAGGGCTCTCCGATGCTCAGT
GACGATACAACAAACTGTCCGACTAAGTTCGAGGCCGACCGAGCATCCTCGACCAACATGGATACCGTCGCCGTGCTAGTGAACAGCCCGATTGCGGACA
TGTTCGCTAATAGCGAGCCCGACGAATCCTCGTTGGTGCCCGTGTTCGATCGACGGTCGATCGTGGATGATATTTGCTTCGGCTCAGAGACGTTTGNGTG
TTCGATCGATGATCGTTTATGGATGATATTTGCTTCGGCTCAGAGACGTTTGATGCGTGTTTAGCGActctcgaccagctgcttcagcgctcCACAGAGT
GTCGAATCAGTGTTAACTTCACGAAGAGCATCTTCGTTCAGTCACGGGTGGACTTCCTGTCGCACGAGGTGTCGTCCGAGGGTATACGAGCCGATtccaa
gaagatcaaggccGTGTCAGAGTTGCTGTTCCCGACGTCGAAGAAGGGGATGCAGTCGTTTCTTGGAGCGCTCAACTATTACAGCTGGTTNCGTCGAAGA
AGGGGATGCAGTCGTTTCTTGGAGCGCTCAACTATTACAGCCGGTTTGTCGAGGACTTGGCTGTGTATGGAGCTGCTCTGTACCAGCTGAAAGACGAAGA
TTTCCTACCGGGGGGTAGCCAAGCGGAGTTTTACAGCGCTGCAACAGAGGGTTGTGGCCGCACCGAAACTGCGGCACTTCGACCGAGACAAGGCCGTGCA
TGTCATGCTATTTGCGAATGAGTGGGCTCTGAGTTCCACGCTGATGCAAGAGCACGTCGGGCGATTGCACCCAGTCCGGTTCTGTGGCCGCGTATTGAAG
GAAGCCGAGATGAATTACCACccggccgagaaggaggtgctaGCTCTTCTCTTACTGTTGAAGGTCTGCTATACTCAGCTGGTCGGCCGAATGATCCACG
CCTACACGCGATTCTCGACGCTAGAATGGGTACACAAGTCCAAGACATTGTTCGGTCGGGCGACCCagtttgcagtgctgctcTCTCCGTGGCATCTGCT
GGTGCAAAGAGAAGGATTGTGTGTTTGCTCAGCTCCTGCAAGCTGGTCTAACGAGCTTTGTCGAGCTTGAGGACTCACTCGCTTTGGTGGCTCCGCCGAC
CAAAGGATCACCGACTACTCGAATGGATCCCCATTTGCTCTATGCGCGTCTACCGAGATCGTACAGAGGCTTCGTGATGTCGTTCGATGGCTCAGCGAag
accgagaagaacggTGGCTACGGCAGTTGCTCGTGGATTTTGTGGCGGTTACCTGAATGGACGGTAGTgatcgctgcgagtgctTTTCTCGAGACTACTA
CGGTAAACCTCGCTGAGTACGCCGGAATGAACAACGGCGTCTCAGCAGCGTTAGCCCAAGGAGCCGAGGATTTAATCATCGTCGGAGACTCNCTAAACCG
AATCGGGGAAGTCATCTACGAGCCTGACCCGGAGACCCCAACGGAGACAGAGGACAAGCCTTCGATCAATGTAACCCGAGTCCGGGTTGCCCACGACCAA
CCTCGAAGCAGGAGCTATTTCCATTTCGTCCGGAACGAGCCCGAATACctggcagcaacgacaaggcGGCAAGCGAAGGCGAGAGAGAAGCGCATACAAT
TTGCCGACGAAGTGTCGGTGGTCGGCCAGGGCGACTCAACTCGACGAGACAAATCGAATGGTGTGCCTACCGAGGCTCCAGGTGATCTGGAAGTGACGCT
ACCGAGCTCGGAAGTCGCCCCCAGAATGCCAACTGCAGACGATGTTGATCCCGTTGCCATACAGGAAGAACATCGGATGCGGATTGCTACCAcccaagat
gaagagctgaGGTGGTCAAACCTCAAGGTGGTGCTacgaggcgaagaagcgaaaCTCGGCTACAAGGCGGCGAGAGACGCATGGAAGATGTCGGACAAGT
TCGTGCTCAGCGAAGACGAAGTTTTCTATTTTCTTGGAGTGAACCGTCGGTGGGGCAccgaacagcaagaagagacGAAGATGCGCCTAGTAGTACCCAC
AACGATGATTCAGGAGGTATTACAGAGCTGTCACGACTCGCTGGAAGGCGGTCACCAAGGTATCGGTCGGACCTATCACAGGGTCAGCGCTGATTACTAT
TGAATCGGCCTCTACGCAGACGTGGAACGACATGTGAAGTCTTGCCCAGattgcagctcgagcaagaGTCCACCGCAGTTCCGAGGCTATTCACCAGGGA
ACATCCTGGCGGAAAGGCCTTTCCAAATTGTCTCTATGGACTTCGTCATACCGTTACCGAAGTCTCGCAGTGACAACACGGCATTACTGCTGTTCAGGTG
CGCATTCACCGGTTTCGTGATGGGCAAGGCAATGTCCGACGCGACTGCACTGNGCAGTGTCGGTCGAGAGCAACGTTGAGCTATCGGCCGCAAGCGAACG
GTCAACAGGAACGGTCGGTGAAGACAGTCATGCAGTCTGTACGCGTCTATGCCGAAGACCCCTTGCAGCAAGACTGGGACGAGATCGCCGAGCGAGTGAT
TTTCGCTATCAACAACTCACAAGATGGAACGAGGAAGGACACTCCGTTTTGCCTCGTTCATCGTTGGGATGCACAGTCCACGCTCCGAGCAATGTCTTCG
TCGCCCCAACGAGGCTCTGGCGGCCAGACCGGTGCACTGGCGTGGTGCCGAGAGGTGAACAGACAGCAGGAGATTTCGTGGAGAATGGCTATGGAATACC
AGGCCACCGAGAAAGCACGGAGGGCGAAGGAACacaaggagctgcttggGAGACGTGAACGAGCGGCGGTACCGACTACTGGTGATGAGAACGAGACGTC
GGGCGAGATTCCATTGGAGACAGGGACAGCTGACGATGCGCCTGACGCGAGACCGAGGTCTCTTTTCCAACCAGGGGACCGAGTCTGGTTGTACATGGAA
CACGTGAAGTCTGGATTGACCAAGAAACTAGCCCACCGATGGCACGGGCCATTCCgtgtgaagaagaaggtcgaggagTTTGCGTACGAGTTGGAATTGC
CCGATCGGAGTGGATATAGGTTTTACCCGGTGGTGTGTGTCTCTCGACTCATGGCCGTGAACGAATTTGCAGACCGACCGAAACGTCGACTGACACCAGA
GGTGACCGAAGCTACGCGAGTagacttcgacgaggagttgCTT