Description :
From Genome Similarity Track
Location :
Scaffold_1738:10- 3589
Sequence
3579 bases(100 bases per row)
CTAAAGCGCTACCTGTCTGGTCTTCGTCTGACCCCACATGTGGATGCTCAGGCCTTACCCTTTGGAGAATGGTCTTTGGGATCTCTCTGGACATGTGCGC
ATCCCTTATTCCTAACCCAGAATCGGTCTGGGCTTTAAACTCGTTTCTGACGAACTGACTAGATTCCAACTGGTGGTTTCCCCTAATCCCAGGGTACCTG
ATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCATACGAAGACGGAAGCTGAGCAAGTCTGCTACCA
TGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAA
GTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGACCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGC
CCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCGCCTCAGCTCCGAGAAAAACTATC
GGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGAT
ATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAGGATTTGGATAAAG
TACTCTGGTACTGCTCTCTTGACATGACCAGCGGTTTTTGGGTAGTTACTATGACGGATTGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACT
GTTCGAGTGGAACCGGATGCCGTTAAGATTGAAGAACGCATCCCAGATCTACCAACGTCTAATCGAAAACGCTCTCTATGGATTCACCCGAATACCGGAG
CCCGAAACGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATACTGGAACCCCGTCCGTGTTAGGACGCAGAT
CTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTATGCGAAAGAGTGACATCCCTGCTGAAGGCGTGTACTAAGTGGAATCTCTCTAT
CCGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTATCTTCG
TTAGCCGATCTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGTGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTG
CCGCGGTATTGTATGAATTGAGAGAGGTAGATTTCGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATACAACAAGCTCTGGCCCGGGAGATGTCGGA
TCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAGCGGAGAGAGGATCCAGTCTGGATAGAG
ACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGAAATTGAGGAACAGGATCGCGACCACGCCTATCCTCC
GTCATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATAAGGGGATCTGTCATCC
AGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTAC
AACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGG
CAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAAGCTTGGCCGCGAGCATCACTCCTCGAGCTAA
GATGGATGAGACGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCTATCCCGACGGCACAGGCAGATGAGGATCTGTACGTC
CTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCCAGATCCA
CTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTG
TGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGC
GGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTATTGAAG
TGGAGAGGGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGT
CACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAACGAG
GAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGGGTCGGGAGGATACCAAATCCTACAGTATGGTTGCTACGGATTACG
CAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAAGATCGGGATGGATTGATGAGGCTGGTGATGCCAGAAACCTTATG
TCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGAATTGGTCGGGCCTACCAACGGATCCGAGAATGTTTCCACTGGAGGGGACTAATCAA
GAGCGTGCAACGGTAAGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTAC
CCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGGTACA
CGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAATCGTACGAGGAATGTGTCTTCCGAAGATTTGGAGCTAGCGAGATGATTCGG
CATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTTCCCAAGCTA
ACGGGTCGGCCTAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCTAGGATTTGGATCAGAGGGATTG