Description :
From Genome Similarity Track
Location :
Scaffold_1115:10- 3511
Sequence
3501 bases(100 bases per row)
TCCTCAAATCGCTTCACCACATCTTATTCATCAACACTTTACAACAAAATGCGCTCGCAGTCTTGCGCTACACATTCAAGTTCAGAACAACGTTATCTGA
AACTTCAGAAAACCGCGTATCAAGTAAATCACCACATCATCGTCCTCCATATTGGTGTCCATACTACTCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCGTGAGATATAGAGCTACCTGTTTATAACCTTGCGGG
GTAGTCGAGCTCGCTCAATCCGAACTACAAGCTAACGTCATCATTTTTCACGGTATTATGCCTGAGATGATTAAACTAATAGAAAGATTAAACAAACAGA
ACAATAGGATGCACCGAATGAATCGATATGGACATCTAACCTGCTTGTACAGCGCAAGCTCCGTTTTTTATCTAGTCATTTCTTAGTCTTTCCTTTGATG
GCTTCCAATATATTCGCCATTGGACCCCTCCGTTTTAGGATGATCATGATCATTCATCGTTACCAGCTAGTGATCTTGATCACCCGCAGCCATCTGCTCG
TGTTCATCATCGATCTGGGTACTATGGTCGTGGTTATGGCTAGCCGCGCCATCGTATCCATCGTGTGCAAACGCCTAATTTCGTAGAAATCAGCTTCCCT
CAATTCGTACNNNNNNNNNNNNNNNNNATATGGCAAAATTTTCAATGAACCGGCTGCAGTAATTCAGGTTTCCTAAGAAGGACTGCATCGACCGCAATGT
CTGGGGAAAGTAATATTGACTAATGACCCCAAATCCTTCGGGTCAGCTTCTATTCCTGGTAATGAAACTTGGTGCCCGAGATACTCGACCTTTCGTCGTC
CCCAAACACTCTAAGGTAAGCTGATCGAAAAATTCCACTGATCACATGCTTCCAATAATCTGTTCACCTCTTGATAGAAAGACGTCCAGGATGACGCCGG
AATTAGAATGTCANNNNNNNNNNNNNNNNNNNNAAAACAGAAGGCCTTCGGTGCGAATTTGGATCGCCGTCTGTAAGCACATCGACCGGTCGAGAGACCT
TGTGATCACTTAACCTCTGTCGATCACCGATCGTGAGATACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNACCCGAAGGCGCGATAAAAGCGGAGACCATTCGTGCACTTTCTGTCATCTCCACAACCCAGAATCCGCTAGTCATGTTC
AATGAACAGTACCTAGCGCTTCGTCCAGATCTTGCAATAAATCAGTGATTATGGGCATGGGATATGCCATCATCCTCTTCAATAGATTGACTCTTCGGTA
GTCAATACACAGTCTTATATCCACCCCATTCTATTTCACGATCGCTACGATCGGTGACGCCCATAGTGAAGTTAGGGGACTACTGATTTTGGCCGATAAT
AACCCTTTGATCGCAGATGACGCCTCGAGCGGCAGGTGGCAGGGCGATTCCTTTACCCATCAGGAGGTGTCATTTCTTCCATATCGGCCGACGTAATTCC
TCTTGCTCCTTGGTCAGTGGGACACCCGGGTCGCCCATCTGTATGTCGTCATTTTTTATCTCATCCGGCCTCACATCCTCTTCTGGTAAGATTGCCATAT
ATTGTCTAACATCCGCTGCAAACAACACTCCACTATCATGATGATATTACAAGCGTTCGCGTGCTCCTTCGCTAGCGATCGTTTTCATTTGGCTAGTCTA
TTGGTCGGAATGTAGATCTTCATCGCATTCCTTGCCAGTGATCACGACTAGGTGATGGGTGGACCGGTTTTGCACGCGATCAGATCCTCTCTCACTGTCC
AGATCGGAAGTGATTTCTTCGAAACAATTCGAGGCTGTGCTTCCGACTAGTCTCGCAACATCGAGAAGTCTTTATCAAATCGGGGGCGCTGTTCGCGTCG
GTCGTTACTGACGATCGCTTCGATATATTCTCTTGGAGTCACTCTGTTGCTCCGGCTGATCAGGAACCGACTACCAAACCACATCACCATCATTACCATC
ACAAGTCGTACCAGGTGTGGTGATCCTGTTGATAACTACCGGTGGCTGTCCTGATTGTCGCCTTTCGAGGTCATCTTGTTTTTCTATGTGATCATATCGG
CGTGGTACCTTCTAGATTTGCTTCTTCTGTTTCCATGGTCGTTTTTGCTATATCCTTCTGCGGTCGCTTTAGAATATGCGTTAGCGTTGGATATGACGGG
TGTTCAACCAGNNNNNNNNNNTCTTCAGGCAATGCCTCTCCTTCTTTTTCCGTAGTAGCTTCAAACGCGATTGTCTGCCACTCCTGATATTGTCGTGACC
CCATGGAAACATTCCCGGGTGATCGCGGTATCATGTCCTCCTGGAATTATTGTCCGAAGGGCGTCCCTTGTTGGGTGATCACCTCTTGATCACTAAAGTT
AGTCAATCACAGGTACGTTAGTCCTCCGGGTTCGGTCGTTGTATTAGGTACCCAGCTTGAGTGTCATTTTAACCACATTTCGACTGTGGTGGCCCCCGAC
CAACATTGACTTCGACAGAGTTATCTACCGGGATCGTCAGGTACATCTCATCCGCGGCAATCCGTTGTATCTTCGCCCCATACTGTGGACTTCTTCCTTC
TAGTTGAATCCTGACATCGTCCGGCAAACAGACCGTCCCGTCGGCTAGGACAAGGCTTATCCCGGTGGGTACCATAAAGTCCATCCCCGAAATCGCTTCT
TGCCCACTTGGTCACCAACCCATATATGGAAGTAGTAGACTGGTGAACCGTTAAACGTGATCTTTACTGTCGTGCGGCCTTTGGTCATGTACGAATTCTA
TTTGATACCCACGCATTCTTGCTTCTGACTATCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCTCCTGCCTTCGCCTTCCTGAACCATTTGTTTGGAGTGTGATACTTCCAGTTACCATGTGATTCACCAGGAGACAACTC
GAGTTCCATCCTGGTAGGTGATCGTGCATATTCATTCGGTCGCCTCATACTTGCGATTGAAGGCAAACATCTTAGATCCAAATCACATGTACTGGAAGTC
CGACCGGTCAGGCGATTAACTCTATTATCAACCCCTTTTCTTTCAATGAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACCTCGGCGTCCGCATTT
C