Description :
From Genome Similarity Track
Location :
Scaffold_1869:10- 3258
Sequence
3248 bases(100 bases per row)
GCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGTGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCTGCGTCGTACACGAGCGGATCCATCG
ACACATAGGACGTACAGATCCTCATCTACCTGTACCGTCGGGATCGGGATCTGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCA
TCTTAGATCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGC
TGTCCACTGTCCCAAACGTCCTTGTAATCCGGCCTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCCCCCCACTAGCAGGTTG
TAATTCAGATCCAACACGCGCGGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTG
AATGACAGATCCCCTCATGTGGTTGTACCAAGGCTTCTGAGACCGCCCAGTCACTGGAATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACG
GAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTC
TCTATCCAGACTGGATTCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTATTCCTTCGTGGATCC
GACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAAATCTACACCTCTCAATTCATACAATACCGCGGCAA
AGAGAGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAGAGATTGCATCGCCCGTTACGACTGCGGGAAGGACAAATCGGCTAACGA
AGACAGGTCCTTAGGATTCGCCTCCAATTCCTCCTAGGAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAG
AGAGATTCTACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCT
GCGTCCTAACACGGACGGGGTTCCAGGATCCCCCGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGAATCCACCCCTTTTGAGTTCC
GGTATTCGAGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGCTCTCCAATCCAAACAGCATCCGGTTCCACTCGAACAGTC
CAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTT
ATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATTGAGTCAGGCCGTTAACCAGCCGGTAATCTATGCACAGACGTATATCC
ACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATA
GTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTTTGCGGGCAGCGGGCGG
TAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATTTTCTGACGTAACCGATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGA
ATATCGTCAATCATGACCTCCTCTGTGGTTAGTGGTACCTCCGGGATTACCGCCAGGCCTTCTCCGAGATCTTTGGCGTGTAGATCCCCGCCTTCATGGT
AACAGCCTTGTTCATCTTCCGTCTTCGTAGGATCCATCATTGGATCCGAACACCGCGGCCTTCGTTCGCCTGGCAGTCCTTCTGTCTTCGGTGAATCAGG
TACCCTGGTATCAGGAAAACCAACAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGTCCGACGGTTCTGGGTTTGACTAGTGTTGCCACTCTCGATAG
GGATCCAGGCACTTTATCCAATGGGAAGCTTGGATCCACTCGTGGATCAGCGGATCCGGCTGTTCGGCTTATGCCTCTGCAATCCTCCATCCACCGACCC
TGCGTTATCTAAGGGCCGACTCTGGGGATCGTTCCCCGTCCTGGATCCAACCTCCACTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGC
GGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTCCGAGCGATTCGATCTCGGTAGTCGCCTCGTACACCA
TATTTTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATG
GTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTG
ACCAACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCCGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCA
TCTTTGCTCCATACAACGGTCGCCGTCCGCTGAACTGGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCG
GTATTATGAAATCCATTCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAGATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGAT
CCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCG
GTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTTATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTG
GGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCA