Description :
From Genome Similarity Track
Location :
Scaffold_2135:10- 3021
Sequence
3011 bases(100 bases per row)
AGATCCAGGGTTGGAGAGACTTCGGATCTGGAAAATTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTTATGTAGATCACGTGTATTAT
CGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTTACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACC
CGTCGAGTGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGAATCAAACCATTGGCGGATCTGGTTGTAGAATTCTT
CCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGAC
CAGATGTTTACAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGATATCTCGGGATCTGTACATA
CCACGGTCCCGGGAACGGTATCCCCCGACCGCGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGATGCTGTGAGACAGACTCGACGGTAATCCTCTGG
GTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGACCTGGAGCCGTAGGCGTCGGAGCCTTTTGG
CGATACTTGACGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCAATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTGGAAGACGTA
ACAGGGTCAGCCTGTCGACCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACGTTGGATCCCCCATCCTTGATCTTCAA
CTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTACCACCGACACT
CCCAATCCACAGTACTGGGTCTGGAAGATGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCTCCG
CTAGCAGATCCGCAAAGGTCAAACTTTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTC
ATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCT
ACCACTGCTGACGAAGTGGATGGGCCATCTCGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTCCCTCCACTGACTCCATTTCCACGTCTCGTGCTC
CATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCC
CGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTTCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGC
TTCTTGCCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCACGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTC
GGCTCCTCGCCCACGCTTCCAACATGGATGCCCCGGAGGGTTCCTAAAGTCATGCGTCGTGTTCGGACGACGTGTCTGACTCATTCTCAGCGGCGGATTC
GTAGCAGCTTGGTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGA
TACTATGATCCCAGGTCTAGCCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATACCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCAC
CAGCTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAG
TCGCGTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTTTTCCGACTCTGGAGCTTGCATCT
TCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGAGTTGGCTTAACCGGTGAATCTGCAAA
TGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGAAGACCTGGGGAGGATAGAGA
GGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCG
TCTTCGTCGATCCGACCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTTACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTG
TGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCCCCCGATGATCCGTG
TTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTG
GCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCAATCTGCGTTCGTGGATGGTTCCGAATCCTAAGCGATTATTCGAGCTTATGGATCCGG
GGCCTAGATCGTGGATCTGGCCGTAGGGCTCCTTGCGGGTGTGTCCCTTGCCTTTGTAGTTCCTTTACGTCGTACTTGCCGCCTCATGTGACGGGATCTT
GAAAGTTGAGA