Description :
From Genome Similarity Track
Location :
Scaffold_1642:10- 2837
Transcript NameFunction/comments
Phymu_g13506hypothetical protein

Sequence
2827 bases(100 bases per row)
CCGACCGGGATCGTCGCTTCCAACGTAGATCGCGGATCCCACCCATGCACCAAGTAATGAGGAGTATCTCCTCGTACCCGATCGTGGGCTGTATTGATCG
CGAACGTCAATCGTTCAGCGTACTCGTCCCAATCCTTCTGATCCAGATCGTAGACGTACATCTTGATCGCCCTGGTCGTCGTCTGTACCATCCGTTCCGC
CGTTCCATTAGCTTGGGGTCGATATGCCATTGTTGCTCGCTGTCATTGCCCTAGGATCCGATTTaacgacttgaagaagtcggacATAAATCCCGGCTCT
CGATCGTGCCGGATCATTTCGCTAGCACCGAATCGGCGGAACACACATTCTTCGTAGGATTTGGCGATCGTCTGTGCGGATCGGGAGGAACTGGCCTTCG
CGATCACGTATCCCGTGAACAGATCGACCCAGATCAACAGTTCAGTGTTTCCTTTATCCGATCTGGGTAGAGACGGTATGTGATCCATCGCAATGATCTG
GAACGGATACGTCGCCTGCAGATTTCCCGGGGATTCACCCCGGATCGTAGGTCTTCCTTTGCCGGTGTCGCAGTCTACGCATTCTCCTACATATCTCTGC
ACACTCCGATATAGGCCCCTCCAGTGGAAACGATCTCGGATCCACTGATAAGTGCGACCAATTCCTTGGTGGCATCCTTCCAGGGTGGTGTGATAGTGAT
GTAGGATATCTTGCTGGAGAGTTTCCAGAAAGGCCAATCTCATCAGTCCATCTCGATCGTCGTTTGATCCCGTCGTAGGGGAACAATAGAAGAGTAGATC
ATGTTCGTCTACCTCGTAATCTGCAGCGATCTTGCCGTAGGATCGAGATTCAGCCTGACTGAGATCTGCGATCTCCCCGATCAGATACTTCTTCATTCCT
GCGATCCAtacttcctcgtcttccgCTCGCCTGATCCGATCGATTCGCATTTCTCGGATCAAATCCTCTTGGAGGACAGCGGGGTTGGATCGTGCACGGG
TAGCGGCCCGTGTAGCTACAGCTGAGACCCGTACCACCGGATCTTCGATCTTGGGTACaaggatctcgtccagtCGATTCAGGGTGACTAGATCCTGCCG
ATCCGCATCCTTGTCAACCTCGATCCCGCCTTGTCGCTGAAGAGCGGCGCTCGCCAAGCTGTCGGCGCTCCCATTCCAGTCACGCTTTACATGTACCAAC
TCGTGATCGCCCCACTTCTTCAGGCGATCAAggaccttctgcttcagtaGTGTCAATCCCGGGGCCTTGTAGTCGATCTCACCTCGGACTTGCCTGATCA
CGAGGTTGGAGTCACCACAGATCACCAAACGTCGTCGATCGAGGTCGttcagcagttccagacCTAGTAACAGACCGTTGTATTCGGCTTCATTCACCGT
AAGACTCTCGGCATAGCTTGATCTAGCTTTGATCACCTTCCACCCGGGCAGACTCCACACGCTCGCGCTATAGGCTCCCCCGCCTCGTTTCACACGAGCC
GATCCGTCAAAACTGATAACCCACAGCTCTTCATCACGATCCACCGTAGGGATCGGTGCCTGGATACGACGCTTGGGCTCCTTCTGAGGAGCGATCGCGA
TCAGAGCTTCGTCGATCTTGGATCTGGGTGTGATGCTGGCGGCGATCGCCCCCAGTATTTCGTCTTCACCCTTCGAGCATTTCGTGATCTCAAGCGCCCA
TGGTGACAGGAGTGCAGACCACTGACCCAACCGACCTTGGAGCCCCGACGACTTGAACAACCAGGCAAACGTCGAATGTCGAGTCAGGACCTTGATCTCA
CGTCCGGCCAGCATACTGTAATAGAGATCAAGGATCCGCAGCAAAGCTAGTACTTCTTTCTCCGCCACGTTGTAATTCAACTCGTTCACCTTCAACGTGC
GACTAGCAAAAGCTATCGGGTGGTAGATCCCGTCATGTTCTTGCGTAAGAGAGGCGGAAATCGCCCAATCGCTGGCATACACGATCACCACCGGAGGTTT
CGCCACATCAAAGTGACGTAAGATCGGTGTTGACGAGATCTTCAGTTTCAAGGCTCCGAATGCCTGGTGGGCCTTGATCCATCGTGCCTCCACGCCTCCA
ATGTTAGATCCGAGATCGATCGCCCCCAAGTCCGGTTTCGGGACTAGATCGGGCTCCGGTTCCTGTCCTGTCGGCGATCTGGTAACTTCGCACTCTAAAC
GATCGGGATCCTGTGTAATCACGTCCATCCGATCCATGATCTTTCGTAACTCGGGTCTTTTCCGCAGTTCTGCGAACTCCACTTCACGTAGTTCATACAG
TACTGAGGCATAGACTGCGTAATCCTCTATGAATCGNTTCGCCACGCTGATCGACAGATTCCACTTGTCACAGGCGTTCAGTAGATCTTCCACTCTCTGG
CACATCTGATCCCACGATCCAGTGGTGATCAGGATGTCATCGATGTATGATCTACGGCCCAACACCGATGGTCGACCTGGATCTTCCGGGATCCCCGACT
CGAACACGTCGACCAGGCCCTCTGAATCACCTGATCGCGAGATCTTCAGGAATCCGTACAAGGCGTTGTCGACAAGACGTTGGTAGATCTGGGGAGCATT
CTTCAGTCCAAAAGGCATGCGATTCCATTCGAACAGACCAAATGGGGTGATGAACGCCGAGATCGCGCGAGCTCGATCGGTCATCGACACCACCCAGAAT
CCGCTTGCCATATCCAGTGAGCAATACCACAGAACCTTGTCTAGATCCTCGAGCAGGTCGTTGATCAAGGGCATTGGGTAGATCATTAGCCTCGTGAGGC
TGTTCACCAGTCTGTAATCGATGCACA