Description :
From Genome Similarity Track
Location :
Scaffold_1490:10- 2755
Sequence
2745 bases(100 bases per row)
AGAATGAAGAGACAGGGATTGAGTTCGTCGTGGAGAACGCCGAGCAGTTTTCGGGGCCTTGGCGAGCGGCGAGGTTCGGAGATGCCGTCCATTTGTACTG
CCACAAGGTACGCAAATCGGTGCGTATAGTAGCTCCTCCAGACTCGAAGCGCGGTCATGCCATGGCTACAGGAGGCAACTCGCAAAAGACGACGTTGCGG
CTTGTGTCGCCGTACGGACACACAGGACCGCTTCGTTGCGGCAGTCAGGTGTTCTTGCAGCTTGTAGAGGGTGAGTGGGCGGGTCAACTACTCGGTATCA
ATGGAGAATTTATCACGGCCACGAAGTATTCGCCGGCAGTATTCCAGCTAGGCACCATCAACGATGAGCACAGCGCCGTAGCTTGTCCAGAGGCAGCTAC
GACGCCTGAACCACAGCCAGTTGAAGACGCGAGCCCAATAGTTCGCTCTTCATTGCCGAGGAGTCCTATTCCTTTCAAGCTGCGCGTCATGGTGTACAAC
GTGTGGCTGCTGCCCAGCTTCGTGTCGTCTTTCAACGAGAAGATTTCTCCGTGGGCCTCGCAGCGTACCTCAGCTATTCCACGTTGCCTCGCTCCGCTGG
ACGTCGACGTCGTGATATTCTGCGAGGCGTTCTGCAGCACTTCGCGCGAGAAACTCGTATCCGGGACGCATCGTCGACCCCTTGTCGAAGGTCGCGTTCG
CCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGGTCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCT
CAGACAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGA
GCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTCAGAGATGGGCCTGTGAAGACCT
ATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGTACGTGGACGTACTTCCGGAAGAGATCCCTGCGGAACTTCCGCAGGACTAGGGCATCCAGCACGAGATTGATCTCGTGCCGG
GGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCACGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCG
GGAATCGAAATCCCCACACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACG
ATACCGGCGCAGACACCGATACCGCGAAAAGATGCCATCATCGAT