Description :
From Genome Similarity Track
Location :
Scaffold_39:10- 2607
Sequence
2597 bases(100 bases per row)
ccactagaaatactctgcaacaactcctgaactctccggtcggtagagtacagttgtttggccgagtgcgtcacagtcgcacttggtgtttggatactag
taacaatttcacggtttcgagcagcttcgatgagctcactgagactaacctgagcggctttatgctcaaagagtgggtttcgggacattgcatccgacac
ttggttactttctcctggaatccacttgaactgcggttggaattcagctagctcgttaaaccagtgcgcaacacgacgattggttgtcctttgcgtcaat
atagtctcgatgctcttgtggtctgtctccacggtaaatgggcgatcgagaaggtaaactctccacacgcgacgggcatgcatgatagccagtaactcct
gctcacgaacagggtagttgagttccgctggtttcattttgcgtcctgtgtatgcaatcggatgctccaaccctccctcgttttgaaacaagactccccc
tatggcaaaattcgaggcatccatacgaataccaaacggtttgtcgaaatcaggaagttgtagcacaggaggggtggaaagacggcgtttgagttcatgg
aagcattccaactgatgctcagacaaatgttacatttcctttgggcgtaaacccttagtactttcgtgcagtgggcctgcaaattgtgcgaagtcggcgc
aaaaacgtgagacgtagacagtcgtacctaagaagctttccatttgtttcttggtacgtggaatcggccactcgctgatttcgcgcactttgtcagggtc
cattcgaacaccatgacgacccacaaagtcaccgagacaggggatttcttcgacgcaaaactgacacttcgacaattttacgtacaattactgttcttga
caccgttgaagcactctgtccaacgcgttgacatgcacctgcatgtccttgtcttgcgtaaaaacgttgatgtcgtcaaaatagatacgcatcacatcgc
gcaagtcactgaacactggctgtaacagcctgttaaatgtgcccggactaccgctcaaacccatcggggttacaagatactcaaaccgcccatcgggcgt
cgagaaagcagtaaatggaatatcagcttcacgaagtttaacctgatagtatccccacaagaggtccatgcaggagaaccagtaactaccgcccatcgca
tcaaatgtgtcttcctttctcggcatcggtatcgctggcaaaatggtggcaatattgagttgacgataattgtgcacaatgcgccaacccacgggcttct
tgacgcagaacgtcggagcgctgaatgcagaggtgctaggtcgaataatgcctgcctgcgccatctctttcgtccaatcctggatcaccgttcggtgttc
cgggcttggcgccattatttcaccgaaatcggttgtgttcccggctggagttgaatttcgtgttcaatcccttcgcggacagggtgtgtggtacttggca
gctcagtgcgaagcacagtatcgcgatacttgagcaagacttcaaatgcggggttgttcaccagtgcctcccatttttaacacctggacgggataacact
cgaagaagcaatgcgtagcagcctctataggccggcagccagggctgcgccagcggtaatactgtactcaagtgaccctggcctatagactggaggttta
ttggctagactttcggtatttgccagtggaggcgctttttacaaatttattaccaataattgggtcaatttgatattgtattgaggtcagtgtagtccag
taataatatttatactgaaaaaactaattatttattgtattgcactattttttcgacctctgGGTCTGGCGTCACCCGGCTCAAGAAATCTCGCTGGAAG
ATCAACTTGAAGAAATCGACTTGCTGGAGCCCGCTCGAACTCAGTGGGCGACGCGAACCTCAGATGATTGCTTTAGGAAGGTAACTCCCAGAGACTTACG
CCTGCAGAAATTGACAAAGCGTGAGCGTATCCAGAATCGGCTGCCGAAAGTGACATCAGACCCAACTCAAGGGGCTACTCGCCGCCAAGCGTCGCAGCAG
TAAGAAACACTTTCGCGCGCTAACGAAACTTGCATAGCTTTAATGCGATCCAATATCACGCAAATGCATTTTAAAACGTTTCATGTCGCATTTAATCTCA
GCTTGCTCACAGCAACCAGAGTGTTTTTCGTCCTGGAAACCGCTTCACATTCGGAACTCCCTTTCCCGTTCAGGTTCCAGTTTCACATGCAGTCTCCATC
GTAATAAATTCACTTAATACATACTCATAGACACAGACGTGGTACCATTTCCGgagacgttcctactgagcattaggctcaggtggctcgtccccggatt
gcatagcccagaatcttgcctgcgctcgatcacttttattgaacccgtacaatagagcaccacagttgagctgggaaacgggaagccatGgtcgaacggc
tcaagtaatagagtgctccacgcgcatcgagaataaactggctcgcaatcttcgcaacatcttcggtttccgcggacgacagcgattccagatttcc