Description :
From Genome Similarity Track
Location :
Scaffold_921:10- 2435
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_921-snap-gene-0.7Nuclear export factor

Sequence
2425 bases(100 bases per row)
CCAAATGATGAAAGCCCTTCGTCGAGAAGATCCGCAACCACGAGTTTCCACCCAACTGACTGTCTCCCATACTTGGATAGGGCTTTACCGACGACTGAAG
GGATAGCCATAGATTCCCAAAGTGGTTCGATCATAGCTGGAGCATTCTGAGCATCGCTGAAATCATGCTGACGTCTCTTCAGTCCGATAAAATCGGAGGC
AGCTCGCTCACCACCAAATAGCCAATCGAGAACGTTGGTGGGCTTGGTCGGAGCACGATCAACGAATGCTGACGCCTCTATTGGCACCGCACTTGGCAGA
GCCTTCGACTTAGCCACAAACTTCTTCCACACATGAAACTTCAGGCGAAGCATTGCCAAACGTTTTTCtGAATGCGGCGCAATTCTTTCTGGCGAGCTGC
TTCTTGTGCGAGCTTTATTCTTCGCTGACGCTCCATCTCTTGTCGCTTCATCTCAGCAGCCAATTCAGCTTGTCGAAGACGTTCAGCCTCGATCGCGGCT
ACTCTTCTGCACTCCTCTTCTTGCCGCTCGAGTTCGGCTCGCTTCTTAGCCTCCTCCTCAGCTCGCTTCAAGTCAGCTAGCCGTTTGAGTTCCGCAAGTC
GTGCTTCTTCTGCTGCAGCCTTCTCTGCCTCAACTCGACGGCGCAACTCCAGTTCCCGTTCAGCCTTTTCTCTCAGCTGATTCGCCTCTTCACGTTTTCT
CCTTTCGAGCTCTTCTGCCTGCTTGGCTGCCTCAGCTTCAGCAAGGGCTTTCGCTTCGGCAATCTTGCGTTCTTCTGCCCTCCTCGTCAACTCTTCTTGG
CGTTTCTTCTCCTCCTTCTCTCGCTCCAGCTCTTGTATACGCTGCATCATGAGTAGTTTCGTCTGCTCCACCTCAGCTTTTCGACGAGCAATGGCATCCA
ACTCAACCTGCTGAACTTCCACGTCTTCATCATCCTTTACAGACGAATCAAATGGACGGTGTGAAGAACCTGAGACTCGGGACACGTCTGTATCACCCTC
TACTTCAAATGGATCGGAAGTGTAAACCACAAAGTTGGAATAATCATCTTCATACGGCGGGCGAGCTGGATAAAGGCGTGATCGCTCACTCTTCTCAGTT
TCCTCAATTAGCTTGCTGAGCATCGGATATTCATCGGGCTGGTACTCAGTCACCCCACGACAAACGTCACGTCGCAAAAAGTCCCTGAAACATGTAAGAA
AATAAGTGACTTGCTTTCCACCATGAGCTGCTGATAGATTACCCTTGCTTTTGACCGACGTAAACaTGTGAAGAACGAACCGGAAGCGGGTTCTTGTTTT
GCCTCAATTGAATATCTAAGAGACAATTTCCACACAATACGTTAGACAATACACGGGTAATTTCGAATCGATTTTCAAACCTACCTGTCTCAAACTCCCC
GCCAAAATTGACAACAAGTTTCCCTCCTTCATCATCCGACTGCGAAATGTCAAGTCCATGGTGTTCGCACACATCGATTGCGTGGTCAAGGTCGTCGAAA
CAAAGCAAGTCGACAATGTCTTCGAGTAGGTACTGTTGGTTTCGATATGCACGATTCATACGCTGCAAACCAAGAGATCTCATACTCGGAATGTAGCGAA
AAACCAAACAGGCCTGCAGATAAGTTGCTCTGCGCAAAAGTCGGAAAAACTGGTAATAATCTTGAGTGTGACGAGCGACGAATACCTTCATTGCGAAGTC
AACGTGAGGACTTTCACGAACTCTTGGAGACAGACCCTTCACGAACTTGAGTACATCAGCGCCGCGTCCATTGTCTAATGTACACAAAATGAAGTACCCA
CGAAACTCAGCTTCGAAAGGGCTGAGGTATGATGGATCACTAAGTTTTCGACTCTCATCATAAAGTTCGTTGAGTGACTTCAACGTTTGTCCCAGCTGCT
CCATATTTTGTTGAGCAACGAAGGACTCCACTTCGCACAGCTCGTGCTCACTCAAGATGTGGTACCGCGCAATGCGTTCGTGGACATCAACGGCAATCGG
ATGTACTCGTCCACCTGCGCCACGATAGTTTTGGAGAACGAAATCTTTCCGAATCATTCGGCATCGATCCCAACAGAAGTTGTACAGTTCAATCAGTTCT
GGAGTACGAGGTGGACTGAAGCGTGAATCAGGACCAAGAAGCTCTCGATCCATGATTTCTtGTTCAAGATACAACTGGGTGAAACGAAGTACCCCCGGcG
GACGAAGCTCTGATGGGATATCTAGCTTGTGATCAGCAGAGCTACGCTGAAATCGCTTCACAATCAACTCGCGTTCTTTTCCTGGGTCACCAGGAAAaCA
CTTCTCGAAGACACTAAGCTCATCCACTCGAATATGTAATTCACGTTCAGCTGGACTGCACATGTCGACGCATGTACCGTCCAAATTCTGAGCTGACGAC
AGCTCTGCCTTATTTTTCATGTCCC