Description :
From Genome Similarity Track
Location :
Scaffold_372:10- 2386
Transcript NameFunction/comments
Phyci_21022hypothetical protein
Phyci_178754hypothetical protein

Sequence
2376 bases(100 bases per row)
cccctgcgaacacgacagatccgatttggattttggttcaccagcttggaaagccagtcacgtacaagaagaagcagtacacgcatattcgcaaggtgtg
tttggagaccaaaacctggcaaaacgcactttgtcacgctagccacgcctcaaacgccacgacgcatttggtatctgcccacaagacgcatgagatggca
attctggagcttcagcgtcgccaagttcgcgctgaccgcttcatggtgaccacgccgacagagacaaaaaccccagctgaagacgagctatcaaccaagc
gccaaaagactcggtggaaggcgccggtcagccaagaacaaatcactggtcacatcgggcggtggctgattcgggatgttccggtttacttttacggaca
atgtttttactgttgttctcatttgtattattttatttgcctaggattggcccacaacctcgtgacaacagatgcctttcacgactttcttgtaggtgTT
ACTGGGGATCTTATCGTCATCATTCCATCCGTAAGACATACAACGACATTATGGATAATCACTACGACACTTTCTTGAAGGATACATCGAATTTATTTGC
CGAAGAGTTCCAAGAGTTGGACAAGACTCCGCTTATGACTGTGGAGCACGACCAGTGGACCAACAGTTCGAAAAACAGTATTGTGGGTGTATCGGGTAGC
TACATTACTCGACATTGGCGTCCTGTGCGCCTCGCTCTGCTCGCAGAAGTAAAAAATGATGGCCATGATTCCGAGGGTTTTGCAGAGGTGAATGATGAGC
AGCTCAAGGCTCGGTACGGCATGGACATTAAGAAAATGGTTCGCTTCACAATCTCAGATACAGCACCAAGCAGCTCGAAAGGTTTCTAGACAATTTGATA
CAACTTTGCAAACGGATTGCGCGATGCACACTCTCAATCTTTGTATTGGTTATGGAATCGGCCTCAAAGATAATGTGCGCAATGAGTACGTGATGGATCC
GAAGACAAACGTGTTCGTGAAGAAGCGCGTTGTAGTGACGGAAGGCGGTGCACTCATTCGACAGCTTCGTGCTCTCAACAATTTCTTCGCGTCGAGTTAA
TCACCTGAGCGTGTTGCCCGCCTCAAAGAAGTCCAAAATGTCAACAAACTACCGCAGTTGGCGGAGCTAATTGATATTGACGTCCGAGTGGCATCTACCG
TCAAATTATTTCAACGTTCAATCATTAATTACCCAGCGTTCCAAGCATTCTTTCAGGATGCGAACTGGCCTAAAAAGGACAAACGCGTTTTCAACTGTAT
TACGGGCGCTGAGTGGGAACTTGCAGTACAGATGGAGGCAATCATGCAGAGAGTCTGAACTAGCTCTTGCCGAGTCCCAGTCGGCAACCATGTTATCGTC
TACTATGTACGTGTTACTCAGAGTGGCGtcggctcgaatgaattcgtacaagtttgcaacctactgcctgcatggacctcgcgatACCGACACTAACGAG
AGGAACTTCTCTCGAGTTGAGCTGAAGCTGACTGATCTCTCGGACTTGGCGCACCGGTGTATTAAACGCACTCTGCATCAAATTGCAGAGAGGTTCCCCA
AACCATCAGTACCCGTAGGTATGGCGCTACTGCTTGACCCACGAACGAAATCGTCAGCCAAAAGGTTTCTACGAGTTCCGGACACGGCGGAGGCTGTGAC
GGCCACTATTTTGGAGGAAACAAAGAGTCTGATGCGCATTGAACACCGTGTTTTTTACAAGGGATTACATGCAAACGACGGATACGAAGCTGTCGAAGCA
GCTTCCAGCACCAGGTCACCTCAAGCAGAGGGCAGCAGCAGTTCTCATTACGAAGCAGACTTGATTTACGGCGAAGCAGTTTCCCAACCAgccgcggaga
aaacggcggatgcaactctaaatgctcaagctgacgcgcttgtgggggagtggctgaacttctgaattgagtggtctgacgtagcgagaacgcaatatcc
agtcaaagaggagttggaaaaggtgttacccaagctgagcatgcgcgacagaaaacgcaatgtttacgtttggaatgttgagcaactttgtgggcacatt
tgacgcatgccgttggttcgcggaggtcggcgaaaaaaaattccttgcgaaacttgcacgcgtctggctgggacgtgggtgctcgacggcgtttcaagaa
cgcgtgttctcaaccggttctttcgtgatgagtcctctaaggacgagaaccgacaacgagggtgcgcagcggcagctcatacttcgccacaaccggcagg
agataaggcgtatggaggccaataagcgccaaatgtggcagcttcaactcagtgatttagtagtcatattagtagt