Description :
From Genome Similarity Track
Location :
Scaffold_561:10- 2337
Sequence
2327 bases(100 bases per row)
AAGCATGAACGCATCTAGTGGCTTCCGCAAAGTTTGTCCTCGTATCCGCCGGAACGTTGGAAAGAATGTGATCGCCTTTTCCTGAAATCCATGAAAAAGC
TGCTGTGAGCGGCACAAGTGGGACAGCTCATCGTGCTCCTCAACGAGCGATTGCAATTGAAATGGCACCGAACTACTGTGACCTTTTCTCGGAAATTCGC
CCGCCCGCTCTCTTACCGTCATCCTAGTTGACGAAATCCGAGCTAGACTCCGTACTTTTGGTGTCATGCAGTACCGAAAGCCAGCTTCATCATTGTGACC
AGACAGCTCACACACCGATGCATGTGGAATTGATGGGGAGTAACACGGCGACGACAAAACCAAAGCGTGCGTATCTTCGCATGTATGATAGCGTTCAATG
CCAGCATTCACAAGTAGCTTCAGCATGTCCATCGGCGTTGCCCCTTTGCGTGTCATCCGATAATTAAAATCGCCAAGAATAAAGCTGTGGTGGTGTAGAT
GCGAGAATCCGAATCCATAGTCTTCCTCATCTAAATACAGTTGCTGTAAAATTTCCATCGCGTCTTGGTTCCGGCGCTCCACTTTAGAAGGTGGTTGATG
TACTTTCATTGTATCCCCGTTAGAGATCGAAGCTTTGCTACTACAGTCTCCGCCGCTACTCCGTCCGTTGTCATTTACCATATTTGCCTCCAGTAAGCTG
TCACTTGCTTTCGAAATTGTGTTGGGGTCTTTCTTTCGCTTGGCCTGCTTCAAGCTTGACGAATCGGACGCTAAGTGACAGGTCACGAAAGCGAATGACG
TACCATCGAACCGAAAAGACATACCGACGGCTCCTTTGTTAGATGCGCGGCCGAAGAGCAAAAGTGACTTGCCGCGGAACACTTCCTGGGCATTTCTGTT
TCTTCGCTGTCTGTGAAGCATCCGAAATCGCCCCGATGCTACAGCTGACGTTCGTACAAAAATGCATAGAGCAATGTACCCGTGGTAGCCCAACGCTGTA
GCTCGTTTCCCGATCTCACGGGAGTAATGCACATATTTGCTGCTTGATCCGGAAACGAGGTGGCGCAGTATCTTCATTTGCAAGTCTGCAAGGTTCATGC
ACTCTTGTACTCCGAATACGTACACATCTTTTCGAAGCGGTATCCACTGGCGCTGCGTATCATCACCATCACACATCATGTTAGATCGCCATGCACGAAG
AGATGAGGCAGTATGTAGCTTAGTATTACCAATTCGCTATCGATGACATCCTTCTCACCCATGTTAAATGTCGATGCGAAAATCGCAATCTTTTTCGGCT
CGAGCGGAGTATCGCAATCATCATATGCTCCAGTAGGTGGTGCATGATGTAGCGAAAAATGCTTGAGCAAACGCTGATGCCAGTCACGATAACTATAGCT
GTAACCTTTCTGGGATAGGACCTTGCTCTTGCAAGGGTAAGTACTCCTGTCTGCACTTGAATCTTCACCATCCGACTCGCAAGGGACTATGAAACCTGAT
CGGACTAGCGCAGTTCCAATGCTCGCGGATGGACGAAACATAGTTTCTTGATCATCCTCCATGATCGCAGATGACTTCTTCACACGGAACCCGCCCACCA
TGCTATCTGTCGGTGAGGGTAAGCTGATGGCATCGCCATCGCGCGGTTGTATATCCTTCTTTGCATATCGACGGCACATGCCTCCGTATACGATTGCATT
AGAAAATCCGTTGAGGTCTTGAATTGCCTGCACGGTGAGGCCTACGTTGAAATTCACCATCCCTCCAGCTTCGAACACTGCATAGCAGAGTATATTATGT
CACTCACTCCTTTATTACCCACAATGACTGATCCAAAAGACGCCAGTCTACTTACTTCGATAGATCATCATTGGTGTGCGATGGGCAATGAAGACGACAA
TGTGGAGCACCAACTTGCGGCGAATCAGCATCGACGACGTGTCGGCCTCCACAGTATCGTGTCTACAAGCATAAATCGAAACATTAACTACATGAAAACG
TACGAACAAAAGTACCGGAGGACAAGCAAGCAGGAACTCGTACACACCTTGCCACTCGCTGTTTGATGTTCAAGTGGATGAGTGCAAGCAGCACAAAGTT
GAACACGACCATGAGGAGATAAAAGACGTAGAAGTTGAAAAACATATACCGGATGTCATCCAGCCAGCAGTAAAAAGTTGCATCCCCGTACTTGTTTGCT
AACATACATCAACATCATCAACAACAACAAGAAACCGCCATGGTCAGTACCCTTCTCATCACTACCCCCTATGTGCCTCTGCATCCTGTCTCCTCCAAGT
TCCATTACTAATGACAAAAAATATATA