Description :
From Genome Similarity Track
Location :
Scaffold_2993:10- 2241
Sequence
2231 bases(100 bases per row)
ATCGAATCGCTCGGAGAAGTGAAGCCCTCCGATGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATC
AACGGGTTGAGATCCAAGCAATGGAGGTTGGGTCCAGGACGGGGAACGATCCCCAGAGTCGGCCCTTAGATAGCGCAGGGTCGGTGGATGAAGGATTGCA
GAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACGAGTGGATCCAAGCTTCCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTA
GTCAAACCAGAACCGTCGGACTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAG
GACTGCCAGACGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACA
CGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCGAGTGGATCCAGGGGCGAAT
GAACCTGCTGAAGTGGACCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCA
AATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCT
GCTGCAAGCCAAGATCATCAGTTTCTCAGCGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATAGAT
TACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTC
TTGACATGGCCGGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGAT
GCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCT
GGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTATATCGACGACATTC
TAATCCCGGCAGAATCATGGGATCAGTTGTGTGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCGTGGTGAAGAGCTA
TTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTCTCCAAGGAGGGATTGGGGCGAATTTTAAGGACCTGTCTTCGTTAGCAGACTTGTCCTTCC
CACAGCCGTTACGGGCGATGCAATCCTTCTTGGACAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTCTTTGTTGCGGTACTATATGAATT
GAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCTGATCAAAATCCAACAAGCTCTGGCCCTAGAGATGTCGGATCCACGAAGGGATCCAAGT
AGTACGACGCGAGAAGAGGACCTAACACAGGACCTGAATCCACCCCAGGACCAACGGGAAGAGGATCCAATCTGGATAGAGACGACGGAGGCGAACTCGG
AAAAGGTGGAGCCTCGGTGGATCTGAGCTCAGCACGCGTTCGTGGAGCTAAGGAACAGGATCGCGACGACGCCCATCCTCCGTCATTTCGATCCGGAACG
TCGACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGG
ACACTGAAGCCGAATGAACTGAACTACGGGGCGGTGGAGAAGGAGATACTCGCGCTCCTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGAT
CCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGATAGTGGGCAGCTTTACTCTCGCCTTG
GACACTGGAGATTGGGAAATGTTCGAAAGGG