Description :
From Genome Similarity Track
Location :
Scaffold_2588:10- 2175
Sequence
2165 bases(100 bases per row)
GATGCCCTCTAAAGTGGAATCTAGTAGCCACGGCTAACGAAGAGTCAAGATCCATCCACGAGGTGACCCGAATCCCATGCTTTCGAGTTAGGATCCAAGG
AGGGAGGATCCCGCCTTAAGGGACCTGGATCCAGGGTATAGGTATGATGGATGCAGTGGATCTAGAGCTTTCGTGGGACAGTGGAGATCACAGACGGTTG
CGAGATGATGTTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCTGATGAGTGTACCCATA
ATAGGGTAACCATAATGATTACGCCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTG
GTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACCTCAATTTGCACAGTATCACGCAAGT
GCCTTCCTGCCCTCAAGAACCGGAGCTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACA
TTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTCACTCGTGTAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGCTCTC
AACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCAC
GATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATATGTGTATTCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATC
CCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAA
AGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATC
CCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTTAGCCAGGGGAA
GAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGG
TGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAA
ACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATGCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACAAGAAAG
AAAACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCG
AGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGT
GAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAG
GATATCTTCGAGCTAGATCTGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAAGGTCGCGCACTATGGAT
CCAGTGTCATCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACCAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTT
TAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCG
TGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAG