Description :
From Genome Similarity Track
Location :
Scaffold_1640:10- 2164
Sequence
2154 bases(100 bases per row)
TGTCATTAATGATGCAATTAACAAGCTCAGTTTGACCATCGGTCTGCGGATTATCCGTTGTAAACATGTCAAACGGGTGCCGAGCACTTTGAAGATGGAT
TTCCAAAACTTCCCCAGTGAAGTGGGGATCTCGATCAGAGACAATTGCCACTGGCAAACCATGTTGTCGAAACACACAGTCCATAAACAGCTTCGCTGTA
CCTTCGGCATCAATAGAGTCCGGCACTGCCGCTAGATGAGCCATCTTTCTCAATCGGTCAACAAAGAACACAATGCCAGTGTTGCCTTCCGAATATTTCG
GTAGGCCAAATACAAAGTCCATACTCATGGACTCCCAACACCCAGTGGGTACAGGTAGACCAGCCAGCGGCGCCGCCACATGTGCTGAGGGTTTCACCCG
TTGACACGTTTCACACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTTTGGGCCACCAATAAGCCTAATTTTACTGAGCTATAGATCTTCTCACGA
CCGAGATGACCACTTAAAGCGGTATCATCTGCCTCATAGAAGATTCGATACTTCAACTCTTCATCATGAGGGACAGTGATACGAGGGTTATCCATAATAT
CTGTGCGATAGCACAACAGCCCATTATCGATAGAATATCGATGTATCCTCGCACGTAAACGTGCCGAAAATTCTATGTCCCAGTCTTCGAACTCCTCCCT
CCCAAGAGCATGTAGCAAATCTACACATTGTTCATCCTTGGCATCAGCCGCACGGATAAAGTCAGCGACTGACGATGACACTGTAGTGACGTGAGCAAGT
TCATAGTCAGGTCGGCCCGATAGCGCATCAGCCAAAGAATTTTGCTTTCTTGACTTATACTTCACTTCGAAGTTATATTCGGCAAAGAATGAGAGCCAAC
GAGCCATTTTCTGAGAGAGATGCGGCGACTGTGTCTCAGTGTGCAATGATGCATTATCTGTATAGATCACAAATGGCTTTGAGCCAAGCAGATATACTCT
GAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGCTCTTTTCAGCAGCTTTGAGCTGTCGAGATTCGAATGCAATGACG
CTTTTGCGTCCATCGACATCTGTTTGTAACAGAGCACTGCCTGTGGTAAAGTCATATGCGACATAGAAGACACTCAAAGGCCGATCAGGATCGTACAAAG
CCAGTATTGGCGCATGAAGGAGACTTTCCGTAACTGCTTGAAAAGCATCATGTTCGGTGTTACCCCAACACCAATTCACACCCTCCTTAAGGAGATTGGA
TAATGGACGAGCCATATCTGCGTAATTCGCACTATACTTATGCAAGTAATCGGCAAGGCCAATCCACTTACCTAGATCTTTTTGGTTCTTTGGAACCGGC
CAATCAACTATGGCCCTTATCTTAGCGGGGTCCGCTCGAAGGCCTCTCTTCCCAATGAAGCACCTCAGAAAAGGAATCTCTTCTGCATTTGCATACAATA
TATTTGTGCGCAGCACTCGAGCACCGCTCGTAAGTGATCAATGTGATTATCCACATCAGAACGACCGTTCGTTGCATAACTATGGACAAGGATGTCCTCA
AAATACGTTTGCACATAGCCTCGATGAGGTCTGCATAGTTGCGTCACCAGACGATTAAAAGCAGCCGGGGCATTTGACAACCCTTGTGGCATAACGAGCC
ACTCCCAGAGCATACCGCTCGGGGTACTAACCGCTGTTAGCGGAATATCGCTTGCTCACATGAGCAGCTAGTAATAACCATCGACTAAGTCGAGCGCACT
GTACAATGTACATCCCACCATATTGTTCTGAAGAACATCCTTTCTGGAGATTGGTATCTGAGCCGGGATAGTGGCTGCATTGAACTTATTATAAGCGTGC
ACAATACGCCACCTACCATTAGGCTTTTTGAAACCAAATGTAGGTGTGGAATGGGGAGGCTTACTCTCCCGCACCATTCCCGCCGCGTGCTTAGCACGTA
AGAAATCGTCAATGACGTCACACTGTTCCGTAGGTAAAGGCCACTGCCGTGTTACGTAGTATTTAGTTCCTGAAACTAGGTCAATTTCATGACGTACACC
TCTATCGGAAGGTAAGCCAGATGGTGGGTTGTGACCCACCACATCTTTAAATTC