Description :
From Genome Similarity Track
Location :
Scaffold_1537:10- 2136
Sequence
2126 bases(100 bases per row)
CACATTGACCACTTGCAAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCC
TCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGCTCCCAAGAACCAAAAAGACTTACGCAA
GTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGC
TGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCG
TCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGC
TGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTG
ATCTTTACTGATCATGCGTCGTTACGCACTGCGACATAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCG
AGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGT
GCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGT
CTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCA
TGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGGTCGGGAGAGACCTATGGCTCGGTGAGCTCGATG
TACTGGTGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGC
GAGTTTGCCTGTCCCCAAGGGATGCTGGCTGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATGAGGGGGAAAACACAGGTATAGTGCTCTTT
GTAGACCGATTGAGCAGATGGCTCATTTAGTCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAAC
ATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGATCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCCGCACTCGTTTGGACATGTC
CACAGCGGACCATCCGCAGACCGATGGTCAGACCGAACGCGTGAATCGCGTTGTTAAGGATACCCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTG
GAGCCAGACGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGACTACACTCCGTTCTATGTGAACGACTTGGTTAACCCTCAC
GTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCG
ATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGAGACGCTATGGCTGATAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAG
AAGCAATGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGA
CCTCGGTTCATAGGACCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTCG
GCTTGCTTAAGCCATACCAAGACCCT