Description :
From Genome Similarity Track
Location :
Scaffold_1065:10- 2129
Sequence
2119 bases(100 bases per row)
TCCGGCTCGCCAAGGATTGGTCTCAAGTCATCGACAGCACTGTGCTGTACACAAGCAATTTACTCTTTACGCCTGAAGCCAACCTTGCAGTGCATCACTT
GTGTTGTGTTTTGCCTGCCTTGCGCATCGTTGTGCTCGCCACGCGAGCGTGCCCACGGCATCGGAAGCGGTGCAAGCGAGAGTTCTGTCTACTGTGGTGC
GAAGAGGCTGGGGATCTGACAGTTCGGACTGAGTTTAGACAGAAGCATTTAGCCTTGTACGTGTACGAAAGTTCACGAACACGACTTGATGCAGCCGAGC
TTCTGCCAAAACTGGTTCCCATTCGGCAGCCGTAATGTGCTGGTCATCGACAACGACGACGCTGACGTGGCGAAAGAGAGCGCAGCGCAAGCACTGGATG
CAATACTGGCGTGCATTGTCGAGATCCGTCGGGTCGAAACGAAAGCCGTGTCGCCCGCGAAAGTAGTCGTCACTTGAGCAGATCAAAGTCTGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAACCTCCAACCCCATCACTTCTTGAGCAAAATCGCAAACGTTGACTTGGAAGGAAAACTGAACCTGCGGAGTGTGACACCAACAGTGAAGGATTG
TGGAGATTTACTAGAAAGCGATGTGGGCAAAAGTATCCTGCATGATGGAGAACAATGAGCGAGACAAGGCGTCAGCATGATGGCATCAATGACAAGAGGC
AGGCATGGCGTACATGTTTATtATGCATGCATGGTAGTCTCATGCTGGCAACGTGCAGGGTGAAGTCGAGTGGCTAGCGAGCAGCCCAGGGAATGCTTGA
CCTGGCGGCCAGGTTATTTCTGGCTAGGCTGGCCAGAAATGTGAGGCAGTCAACTCTCACACATCAGCTGATGACAGGGGATGGACCGTTGCGAAGCTTT
CACTTGAAACTTTCGTGAAAGCAACGGCGTTCAATTGAGCCGTGTGCGAAAGCAACGGCGCTTTTAGCCCAATCCGTGGTCGTTCTCACATTCTCTCCAA
TCATCATTCACCTATCGAACGGGCAATTTTTGCACGATCAGGGGATGTGCAGATAGAATCTACCCACTTTTGGATTGAGGAAACAGTCCACTTTATCAAT
CATGTGATACGGAAAGGCGAAATTATGGTTACGGGAATGTCGAACGGGCAAAcTTTGCACGATCGACAAAAGTTATACTTGGTTTTTGtATTGATACATT
TTCTATTGTGCGAAAGGGT