Description :
From Genome Similarity Track
Location :
Scaffold_2044:10- 2088
Sequence
2078 bases(100 bases per row)
GCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAG
AGGGATATCGCTCTCACGCATTAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAAATAGTGCTCCTGGTCATCGAATCGATGATGACATCT
TTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATCCGCCAGCCGCCCTGTGGCTTCTTGATACAGAACG
TCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTTCTCTCGCGGCAGTGG
CCACTGCCGCGTGACACAATACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGTTCCGCACGGATCTCTTCCGGAAGT
ACGTCCGCGTACTCCCGTAAGATTTCGTAGTAGGGACTCGTCTTCAACGAGTCCCAGCTCCGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAG
TGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGAT
GCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCAACGCTTGCGTCGGAGGATTAGCGAGGGTCGTCTCC
CTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTTTCAGCCTCCGTCTGTCCGGCAGACATTTCTTGTAGCGCCT
CGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGCTTTGCGGAGCCCGGCTCCGCTTGGATCTTGACCTCGTCCAGGCCCAGC
CGTAGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGATCGCCCGGCGCTTCGTCGTGCAGCCCG
GCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCAGAGCCGACTCGCCATCTTCACCTC
GACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCTATTACGGAGAGTGCGTCGGCTCCCTGAGCCGACGAATCGAATTCACCCAAGCCATCG
ACTCCCTGAGTCGACGGCGTTTCGTCACCTTGGCTCTTATTATTGGCCAAAACTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACT
CGCCTGCGTCATCCGTGCCCCTTGTGGTCCGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGT
CGGCGGCGACGCCGACGCTAGCTGCTCTTGCGCGCATGTTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTTGGCGCTGTCTCGAGTGGGGAGTCG
CGCGCACCTGTCGGTGCGTACGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGA
TCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAAATTATCGTCCAGATCCAGGACGATAAAGGCCTCGACAAACTCTTGATCTTCATA
CGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAG
TCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGAAGAGAGCTGCTTGCTCTCATCGAGTTCACGTTCA
GGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGCGAGAATGAATCTCACTGGGGGCTGCAGTCCTCAGGGGGA