Description :
From Genome Similarity Track
Location :
Scaffold_862:10- 1844
Sequence
1834 bases(100 bases per row)
CCcGAGATGATCGAGCGAGTCAGAGACATCGTCTAGAAGAGGAGAGCGTTCCTGATGGGgAAGGgTAATGCCCGGCCGCCAGCAGCCAAaGGAGTTGTCT
GCGACACTGATGTGGGTGATGCCAAACCGATCGCACAGACGTGTAGGAAGGTGCCTCCACAGTTCAGTGAGCAACTCTACAAGCTCCTGAAAGGATTGCT
ACAGTCTCAGTTCATCCAGCCGTCTCAGTCACCATGGGCTTCCCCGATCGTGATCGTGATCAAGAAGAACGGCGTGGACATCCGCCTCTGTATCGACTAT
CGAGTGGTGAACTCACTAACAAGGCTGATGATCTATCCGATGCCTGTGGTGCAAGATCTACTCGAGGATCTCGGTTCACTGCAGTGGCTTTGCTCACTCG
ACATGGCGAGCGGGTTCTGGGTTGTCAAGATGACAGCGAGAGCACGTGCGATCTCAGCGTTCATCAAGCCGTTCGGGCTGTTCGAGTGGCTGAGGATGCC
CTTCGGGCTTAAGAACGCTCCACAGATCTACCAGAGACTGCTGGACAACACGCTGTACCGGTATCTAAAGCTGACGCCTGAGCATCTACGAGAGGACGAG
GAGATCGACTTGTTCGACAAGTGGGAGCCGGCAGGATCTGAGgTGAGCCCAGCCATCGGGAGGAGATCGTATATTGACGATATTTTGTTTGGCGGGTCAA
CATGGGAAGAGATGTGTGAGAAGCTCAAGAGACTGATGCGAAGAATGGGGATTGTCTATTAGTTTACCGAAGAGTCAGTTTGGAATGAGGCGAGTCGAGT
ACCTTGGACACACTGTATCAGCCGAAGGGATCGGCGCCAAGCCGAAGAACCTCGAGGAGCTTGTGAAGCTCTCGTTCCCGACCACGGTGAAGGCGATCCA
ATCGTTTCTGGGCTCGTTGAACTACTACCATCAGTTCGTAGATTAGTTCGCAGTCTATGCTGCCGCTCTGTATGAGATCACGTCGGCCGATCTGGCTCAA
GAAGCTCAACACCTGGGTCATCCCACGACGGCACGAAGAGCTTTTGATGAGCTCAAGCACCGGCTCGCAGCAGCTCCAGTCTTGAAGCACTTTGATAGCA
CTCGACCGACGATCTTGATAGTGTACGCCAACGACTGGGCAATCGCTTGTACTCTGACGCAGATGATCGACGAGCAACTCGTACCCGTGCGATACTTCAC
CAGAGTCCTCAAGAGTCATGAGATGAAGTTCTCCCACGCAGAGAAGGAGATCCTTGCGCTGCTTCAGGCTTTGGCAGGGGCGGCGAACCTCCTCTCGGGG
CGATCCATGCGAGTCTGGACTCGACACTCGACGACGAGCTGGATCTTCAAGGCGAAGGGACTGCAAGGTCGATTGGAACGGTGGGCAGCGATGCCGAGCC
CGTGGCACCTTGAGATCGAGGAGATTTCGCGAGGAGAAGACGCTCTGGCGGCATTAGTAGCCGCACTGGGTCCAGCCAAGTACACGGACGCGATGCTAGA
GGCAATCCGACCAAGGAAAGCGACTGGCAATCCTCAGTATCGACTCCCGATTCCCCAGCTGACAGCCGATCAGGAAGCCTGGGTAGCCTCCTTTgaCGGT
TCGGCCAAGCCGAAACGAGCTGGGGCGAGCTGTGGCGCGATCTTGTGGAGAGCACCTGGTTGGGAGGTAATCGAAGCCGAGACGAAGTACTGGGAAgATG
GTACAGTGAACGAAGCCGAGTATCAAGGCGCGATCActGCTATGGAGCTGGCGCTgAGGCATGGAGTCGAGCACGTGAtCCTCTGCGGCGATTCTCGGAT
CGTCATTCAGCATCTACGCGGTGAGATAGACTGT