Description :
From Genome Similarity Track
Location :
Scaffold_1994:10- 1764
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1994-snap-gene-0.1Novel protein.

Sequence
1754 bases(100 bases per row)
CGCTCGGCCACGCGGTGCTGCGCGAGGTGCGTGAGCTTGGCCTCGAGCAGCGCGGCCTCGCGCCTGTGGCGCCGCGTGGCGTCGCCGCCGTGCTGGAAGA
GCTCCTGCAGCTCCTTGGTCACGCGCAGCAGCTGCAGGTCCGTGTAGCGCGCGTCCACGTCCCGCGCCTGCAGTTCGAGCAGCGCGTGCTCCCACTCCAT
GACGTTGATGGACTTGCGGAAGTCCTTGATGCGCGTGAGCACGCCCACCTGCTCTCGTCCATGCAGCTGCAGCACCGCGTTCAGCGCCTCCACCTGCGCG
CGCGCCACCAGCAGCGCCTCCTGTGCATCGTCACCACCGTCACCGTCATCAATCCAGAGCTCCGTATTGGGCTGCGTCTCGTCCTGGCCCTGCTTGATGG
CCACGAGCAGCGGCGCGGACGTGTCCAGCGCCGCGAGTTCGTTCACCACGCGGCTTTGAGCCGTGCGAGCTCCCTCAAGCGCGCGCTGGCGGTCCGCGAG
CGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACGGCCTTGGCGCGCGCGAGCGCCTCGGCCCGGTCGCGCACCACGCCCTCCGCCAGCACCTTGC
GAGACCGCAGCGCGTTCAGCGCGCGCCACACGCGGTCCTCGACCAAAAGACCGTCCGGCCGGTCCGTGTCGTAGTCCAGCGGCGCCACCGCCGCCTGCGC
CGAGCCCTTCGACGCCTGTGCTGCGGCGTCCAAGTGGCGGAACGGGTCGAGACTGGGCTCGTCGTCGCCCGAGCCGCGCGTCGCCACCTGCTGCAGCGAC
TGCAGCACGCTCGCGGCCGCCAGCGCGCGCGTAGACGCCCCACTGCCTCCACCAACCGCGTCGCCCAACAGCCGNNNNNNNNNNGTGGCCGAGGGCGTCA
GCCTGGGCCTTGATGGATTGTGACCACCTCCGCCGCCGCTCTCGTCCGCTGTGGTCCTGCGGCGCCGGAAGAGCTCGTGGAGCTGGCGCAGCAGCTCGTG
GTCGAACGGGCCGCCGCCGATGCCCGCCGATTCCTCGAGCTCGCGCGCGAAGCCCCGCTCGAGCGCCTTGTCCTCCTCCACGGACCGGTGCCAGTCCTCC
TTGCACCGGTCGCTNNNNNNNNNNCGCCTGCGCCTCGGTAGCGTCGCGCTCGGCGCTGCGGACCAAGAGCTCGCGCTCGGCCACGTCCGCCAGGGCCTTG
CGCCGCGCCTCGACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGTAGAGCTGCTGC
GCGAGCGTTCGCCGCCGTGCGGCCGCGTACCTCGAGCGCAGCGCGCGCAGCTTGTCATCGAACCCTCGCGCGAGCTCGGCGACTTCGAGCCGCAGCTTCT
TGAGCTCGAGGTCGAGCCCCTTGCGGTACTTGTCCTGCTCGTCGCGCAGCCTCGCGAGCGCCTGATCGCGCGCGGCCACGAGCGCGCGCTGCTCCGCCGT
CATGTCCTCGGGTGCGAGCTCGAGCATCCAGGGCTCGGCGGGCACGAGCAGCGCGGCGTTCGCGGCGCCGAGCAGTGGGTCGCGCTTGGCCTCGAGCGTG
CCGCCCATCATGTCACGCAGCGCCCGCCCGCCCACGTCGTCCTTAAGCCGCTGCGCCTCGAGCGCCAGCGCGCGCTGCGCCGCGGCCTCGCGCTGCGCTC
GCGCGGCCTCGGTCTCGTACGGCCGCTGCGTCATCTCGTGCTCGCCCAGCTCGA