Description :
From Genome Similarity Track
Location :
Scaffold_2086:10- 1511
Sequence
1501 bases(100 bases per row)
GGAGAGACTCCAATTGATCAGACTGCCGGCTCTGAGCCCGAATTGTCTGGAGATCTGGACGTCAATTACGCGCTGGTCATGAAAGCGACTGAGAACGAGC
GACCCCAGGCCAAAGACGACCCGACTGTGTTTTATCGAGAAGGTGACGACGCGATTTTGCTGCACGAACTGCGAGACCAGCTAGCAACTCTCCCGGAGAT
CAAAGAGCTGCACCCAGAATTGGACATTGAGAAGGCCGACGTGGGAACCCCTGGTGTGACCACGGCCGCCGAGGAGCAGCAGATCAGGGAGATCCTCAAA
CGCCACCAAAAGGCATTTCTGGGAGAAGGGAACGCGTTGCCACCACCAGCTCGGGGCGTATACTGTGACCTGGATGTGAAAGGCGCCAAGCCAATTGCAC
AACGCTCCCGGAGAGTCCCTCCGCCGTATTTGCAACAAGTGTATGTGCTTCTGAAGCGCCTCCTAGAGAGTGGACTCATTGAATTCTCGAGTTCGCAGTG
GGCGTCCCCGATTGTGATCGTACTCAAGAAAAACAAGGTCGACATTAGACTTTGCATTGACTACAGACTGGTGAACCAGCTTTTGGAGCTCGATTTATAC
CCGATGCCCATGATTGATGACCTCCTGGACAATTTCGCAGCCGCGCAGTGGTTCATGAGTCTAGACATGGCTTCGGGGTTCTGGGCGATCCCACTCACTG
AGAGAGCGAAGGAAATATCGGCTTTTATCTGTCCACTAGGTCACTTTCAGTGGACTCGGATGCCATTCGGTCTGAAGAACGCACCGCTCGTGTATCAGCG
CACACTGGACAACTGTCTGTGGGGCTTTGTGAGATTGCCACCTGGATTGGAGCAAGATGTAGACCCGGATGTCCGAGAGCACTACCAAATCGAAGAGAAT
CTCGAGATACTCACGGACGCCCTGGAAGGTGATGATCCTCAGAATCCCCTCACCGTGTTCGACCTGAACCGGCCAGCTCTGAAGAATATGGGCCCGGTCT
TGGGACGCAGCAGCTATATTGATGATGTCGCTTACGGAGCTAGCACGTGGAACGAACTCTGTGAGAAATTGGACGAATTGCTGTATCGTCTCAGGTATTG
GCGTATCTCCGTGAGCATGCCCAAGAGCTCATTCGGGAAGCACGAAGTGGATTTCCTTTCTCACAAGGTGAACAACGAGGGAATTAAGGCGACACCCAAG
AGCATCCAGAAGCTCCGAGACATGCCGTTTCCCACGAGCCTCAAGGGGGTGCAGTCGTTTCTGGGGAGCATTAACTATTACGCAAAATTTATCGAAGGCC
TCCCCATGATTGCATCCGCCCTCTACGAGCTGACAGACCCTCAAGTCTCTCACGGCGAAGTTCCCCAGAAAGCCAAAGTTGCATTCGAGATGTTGAAAGA
GCGGATCACCTCGACACCACTATTACGGCACGCCGACCGATCCAAGCCATTCTCTGTGATTGTACACGCCAACAAGTGGGCCATCAGTGCAATTGTCGCT
C