Description :
From Genome Similarity Track
Location :
Scaffold_3001:10- 1497
Sequence
1487 bases(100 bases per row)
TTAACCGGTCAACCTGAACCGGTCCAATACGATCCCGCTGTGATTATGGTACGTTGTTTATGCCACCAATGATTGGACGAGTAGAATGATTGGATGACCT
AGGTAGTGAGGACAGTGTAAGCCCCGATAAATCAATCACTTTCGAATCTTCCTTCTTCCGCTCAAGTGCCTTCACTCCGGTCTCCGCACCAAGTGCAGAA
GTCACTCCGTTCAGTCCCAAGCTTCGTTCCAACACCTCTACACCGTTAACAAATGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATGGGAGAGCT
CAGATCGACGACGAGTGCAAACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATG
GATCCGGTGGATCTAAAGATAATACAGCTCGAATGATGGGTCAAGGGAAGAAAAGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATA
GAAGGTAGAAATCCAGGCAGGTATAGGCTTAGATATTAATACAGACTCCAATTTGCACAGTGACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTA
CATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTGGTGAGCT
TTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGCTCTCAACTTTCAAGATCCCGTCACAGGAGGCG
GCAAGTACGACGCAAAGGAAAATACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGAATCCATAAGCTCGA
ATATTTGCTTAGGATACGGAACCATCCGGACGCACAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACGCTCAAGCTTCACC
ACTTGAACTCTTCGGAAGTTACCGAGAGAGCAATATCCCGCCCTACCGACGAGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACC
CCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAAAGCCGTTCACATAGAAC
GAAGTGTAGCCTGTCGAGGCGTGCACTGCATTACTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTC
GGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTTCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAA
GAGGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGT