Description :
From Genome Similarity Track
Location :
Scaffold_2165:10- 1427
Transcript NameFunction/comments
Phypl_g14764hypothetical protein PHYSODRAFT_331926

Sequence
1417 bases(100 bases per row)
CACGTGCAAGGTGAAAATAGCTTTTGAGGAGAGGAAACGGAAGATGAAACCAACGCAGTGCTGTAGCAAGGACCAGTCGCCGCTCGTAGCAGTCGTAGCG
TTAGTTTTAGATTCACCTTCTGCCGCTTAAGCCCTCCTGGTTTCAGCTTTCAGCCTTTACCACTCCGGATCATGGTTCGTCTTAATACCCGCTCCTTCCT
CCACCTGACACCTGAAGTGGTTGAGTTCGAGACGGAGCTTCCGTTCTACGCTAAGGTTTTACACCTAGGCTCGGAAGAGGTGACGTTTCGCAGCCTGGAA
GGCGGTGAGGGTAGCGTTAATCGCGGCGTCGCCGAGGACCATGTGGTTCTAGCCAGTGAAGTAACCCAATCGGGTCGAGTATCGCTGCTCAGACGACCTG
TCTCCGTCAAGCTAGATGCCGAAGTTCACTACGGACAAGTCGTGGCCGTCGACAAGAATCGTCTCACAGTTCTGTCCGGGGATCAGCAATTTGTGACGTC
GATTGGCGCAGTGTTTGTAGTGTCAGCGGTGGTCGCTCTACTGCTAGAAGATGTCGAGTTTCGGAGCGACGAGTGGAGTTCGAGTGACCTAGAGGTCGTC
GAACAAACTATTCTGAGCCGGGTCTTCGGCCGGGGCGGTGAAGCCGCTTCGAACGAGGTGTCGATTATACTGGAGGGTGTGATGAGCGAGGAAAGCCATC
CCGTTGATGACAAGGTGTGTCGGTGGATCGACCCAAAAACGGGGGAGCCCACACACTTCCCTCTCCAGCATGCTGTTGATTTTGCTTATTACGTCGACGG
AGGGGTATTACCGGTGCCTCAGAGCGTGGGCAGTTCATTCTGCCGGATTCCCACGTCAAATCCACCTTCCAGGACCTCCGCCATGTCTCGCGGATCCGTC
CAAGATGTGCAAGAGTTATTTGACccgttcgtggacgacgacgattcGCCTCTAGATGAAGTAGAGCGCGACAATGGAGCAGAAAGATCAACCAATACCG
CGGCCTGCGGTACGAAGCGAACGCAcaacgccaccgccgccgaagATGCCGATAGCACTTCTCAGGCTAAAGGGCAATGCTATCGAAATGCTCTGGATCA
AGATGCATCGATACTAGCAAAATTAAGTGGTGATCCCGACCTCCTGGAGGGTTTCTGTCAATTAGAAAtgaggccaaggccaaggtgcagCCCGAGGCAC
AACGTGAAGGCGGTGTTGCTATGCCTATCAGAGTGAAGAAACCGGCTTCCGTATCAAAAAGCGAGCAGACATCGAAATACGCGTTTGCACCGTCCGAGGA
ACAAGTGCTCATACATGGTCAAATCTCGTCGGAGACGCATAAAGGTAAGTCTGCCAATGTCTTTTGCAGAAGTTTGGTTCGGTCCGAGCACGTGGAGTTC
AAGGCTGTACCCGGTGT