Description :
From Genome Similarity Track
Location :
Scaffold_993:10- 1424
Sequence
1414 bases(100 bases per row)
CGGCTCCCGTGCCTCCACCAGCTTGGCCAGCTGCGTCTGACGAGAAAGCGAAGGCCATGAGATGCGCGCGGGTGTGTATCCATCCAACGCCTTAGCAAGG
GCCTCCTCCGCTCTTTTCAACGTTCTCGATAACGTGCTGGGTGGCAGTCTAAAGAGCATGCACAAAGTGCTCTGCTCCATGGAGCCCACGTAGAAGCATA
GGACTAGGCCAAGTGTCTGGTGGTGATAGCGTAGCTTAGGAGGGCGGCCCTTTGTCGACGGCTTTGGGATGTAATAGAAGCTACAAAAGCGGCTAAGAAG
CTGGTGGAAGGCGGCCCTGCGCATGCATGCATCAAATAGTCAATTCTGAGAAAATAATGCGTGCGTCATTCATACCTTACCTTGTTAGGCTCGTTACGTT
TAGGAAGTTGCGGTCGTGGCCGCTGGTGTACAAGGTCATCCACGCGGCCTCGCAGGGCGTGTCGAGGCACTGCGAGGTCAGGTAGTGGCACGTGCGCACC
GCAATGCGCCACGCCTCCTCTGCCAACGCGTCGTGCACGTCGCGGCGGGCCTCGTGCAGCTTCGCGTTGTGCTGCAGGTACGCCTCGCACAGCAGCAGCA
TCGTGTCCTCTTCCTCGCTCATCTCGTCTGCTCTTGAGTAGCTCTCAAAAATGGCGAACTTCGAGCGGGGGCGAAATCTGGAAGGATTGCGCATGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN