Description :
From Genome Similarity Track
Location :
Scaffold_2112:10- 1328
Sequence
1318 bases(100 bases per row)
GGGGGGATCCAGACACGACCACCCACACGCCATAGACCATCGGTCTCGGTCGCATCCACTGGGCGTGACGCTGCCTTGCTGAGCTGTACTTCACGAATCT
CGGCTCCCTTGGGCCACAAAATTCGGGGTCCTGAAGCGGACGCAGGAGCGAAACGTTCACCTCACTACGGGTAGTCACTCGCTTGACCGAGACAACATTC
ACTGAGGACGGACTGGCTCTGCCCCAGCGAGAGACAATATCTGCCCACACGTTGTCTTCACCACTGATGTGCTCAATAGTGTAGCGGAGCCCGATCATCT
TGAGAGCCCATCGAAGCAATTTCCCATTCACCTGCTGCTTCACCTCTCGATGGGGTGCAAAGATCTGGACCAAGTTGGCGTGGTCACAGAAAATCTTGAA
CCCATTCTCACGTTCCAAGAGGTACGATAGGTCGGCGCACGCCCTGACGATTGGATAAGCCTCCTTCTCGATTACGGACCAATTGGCTTCCGCGCCCTTA
AAAGATCCACTGCGGCAGACCAACATCTCATGCGATTGCTCGTGAACCGCGGTGTCCGTGGCCCAGTTATGGACCTGGGTCAAGACAACAGCCCAACCGT
CCTTCGAGGCATCGGTGAAAAGGCACACCGTGGCCGCGGGCTCCACAAAGTACTGCTTGGTGGATGTGCGCAGCAGTCGCAGGACCAATTGGAATGCTTC
CTCATCTGTCTTAGACCATATGAGATCTGCGCCTGCAAGCTGGGACTTCCTGCGCCCTCGCTTGGCCATGACCGGCTCCAGTTTCGCGTGGAGAGGACCA
ACGGTTCGCGCGTAGTCAACCATAGAGTCTCGGAGCCAGTTGATAGCACAGAGGAAACTTTGGAGGGCCGCTGCAGTGGGCGGCAGGGGCATGCTGGCGA
GTGCATCCAAACGCCGCGGGTCCTGCTCGACGTCTTCACCATCGATCACCTTCCCGCACCACACTACGCGGGGGGCGAACAACTTGCACTTCTTGGCGTT
CAACTTGAGGTTGCGCTCACGAAGGATCTGGAAAAACACTCGCAGTCGTTCCACATAGTCCGATGGGGATCGTGAAAAAAGTAGCACATCGTCGATCCAT
ACAAGGACCGAGTCGTAGAGCATGTCCCGCAGGACCTCATGCATTTGAGCCTGAAAATGTAGGGCCGAGTCGGCCGCGCCTTGGGGTACACGGTGCGGAG
TGAATACACCATCCTCAGTCACAAAGCTGAACACTTCCTGACTCTCATCCGCCAGCGGTAGCTGCCAAAATCCCTTGAAAAAGTCAATAACACCAAAGCC
GTACGCGCCACGCACACT