Description :
From Genome Similarity Track
Location :
Scaffold_3680:10- 1216
Transcript NameFunction/comments
Phypl_g15971hypothetical protein PHYSODRAFT_525100

Sequence
1206 bases(100 bases per row)
CAGAACGCCGACTGCATCAAGGCCAACGTCGAGGGCGTGCAGCGCAAGACCAAGATCTTCTGCACGCTGGGCCCCGCGTGCTGGTCCGAGGAGggtctgc
tggagctgatcgACGCCGGCATGAACGTGGCCCGCTTCAACTTTTCGCACGGCGACCACGCGAGCCACCTGGCGTGCCTGACCCGCCTgcgcgccgcgct
ggccaagcgccCCACCAAGAACGTGGCCGTCATGCTGGACACGAAGGGCCCCGAGATCCGTACGGGTTTCCTCCAGAACCACGGCAAGGTGACGATCCAG
AAGGACGCGCTCATCGAGCTGACGACGGACTACGAGTTCCTCGGCGACGAGACCAAGATCGCGTGCTCGTACCCCCAGCTGCCGCAGTCCGTGAAGGTTG
GCGgcgcggtgctggtggccgacggctcgctggtgctcacggTCACGGAGATCAAGGACAACGGCATCGTGTGCCGTGCCAACAACACGGCCACTCTGGG
CGAGCGTAAGAACATGAACCTGCCCGGctgcaaggtgctgctgccgactttgacggagaaggacgaggacgacctgGTGAACTTCGGCCTGGTGCACGGC
ATCGACTACGTCGCCGCTTCTTTCGTGCGCACGGGCCAGGACCTTGACAACATTCGTAAGGTGCTTGGCCCCCGTGGCCGCGGCATCAAGATCATCTCGA
AGATCGAGTCGCACGAGGGCATGGAGAACTTCGACGAGATCCTGGCCAAGACGGACGGCATCATGGTTGCCCGCGGCGACCTGGGCATGGAGATCCCGCC
TGAGACGGTGTTCCTCGCGCAGAAGATGATGATCCGCAAGGCCAACCTGGCCGGCAAGCCCGTGGTGACCGCCACGCAGATGCTGGAGTCGATGATCACG
GCCCCGCGCCCGACGCGCGCCGAGTGCACGGATGTGGCTAACGCCGTGCTTGACGGCACGGACGCCGTGATGCTTTCGGGTGAGAGCGCCAACGGCGACT
ACCCGCGCCAGGCTGTGGAGGTGATGGCCGCGACGTGCCTGCAGGCCGAGACGGCCATCCACTACGACGACGTGTaccaggcgctgcgcaacgccgtgct
ggacgtgaacgGCCCGATGCAGACGGCTGAGGCCGTCGCTTCGTCGGCTGTGAAGACGGCCATCGACATCAACgcgaagatgctggtggtgctgacggag
acGGGC