Description :
From Genome Similarity Track
Location :
Scaffold_727:10- 1042
Sequence
1032 bases(100 bases per row)
GTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCT
GTCGCACTCGAGAGGTTCATTGGTTCGGGACCTCCCGACGGCCTGGCCACTGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCA
GGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTT
CATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTG
CCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAA
AGCACCTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGAT
ACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCC
GCGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTG
ATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGC
ACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGT
TAGTCGGTCGTTGGACGGACTACAAAGTGCTA