Description :
From Genome Similarity Track
Location :
Scaffold_3157:10- 1016
Transcript NameFunction/comments
Phypl_g15654hypothetical protein PHYSODRAFT_259165

Sequence
1006 bases(100 bases per row)
TCCGGATCTTCATCGAGTTCGTCATCGCactctccgtcttctccgcgCCCGGCTCGAGCCCTTCCCGTGCCGTTCTTCGCGCCCACGATCCCGCCCGTAC
AAGATCGGTCGGAGTGGACGCAAAGGCGCTATGCCCCGTGGCCCAAGCCCCTCCGCTCCATGCGTTTATCGTCAATCTCGGCTCGTGACATCCGCCTTAC
GTTCCTGCCACCGCGCCACTGGATCTTTCCTGCCACCACTGCTCCTACGCCAGCCTCCTGGAACTCCGCGTTGGTGACACGGGCGAACGTTGGTGCGCTC
TACGCTACGGAGCCCTGGGCCTAtttgaagctgccgatgGAGCCGCTCACGTTCGCGTCTGGCGACGCGGCTTTCGCAGCTTTGGTCACTCGTCTCCGCT
TGCACCTCAATAACTGGGCGATGGCCTACTGGGAGGCGACCCACGAGCTGGTCGTTCCAAGCGGCTCGTACTGGGACCGCTGGCGAAAACGTCGGAACTC
GCGCCGGTCGCACGCCGGCGAGCACCTGCACGGCATGTTGACGCTGGTCGTGGAGTTATTTCAGCGCGGCCACGCGGAcatggacctgctgctggacccc
TCGTTCTTGCATTTCACGCCACGCCGGTCGTCCATTGGTCGTTGGTATCCGAGTTCCCGTCATGCGACTCTGCAGGCGGCACCggacgacatcgacgctC
AGCAGCCTTGGCGACGCTTCTTCCGCACGCCGATGGACGCCAACCGCCGGTGCACCGTAACCCACGCACATCCGACTTACTCCTTCCCTCGCCTTGCGGG
CAAGTTCATCGAAGAACTCTAGATGTCCGTCGTTGCATGCGTGTCGTAGTCGTAGCTCACTTACTCCAATACATCGCAACTGATTCTCAGCCGGCTCTCT
TGCCTTCGATATCCTCCCGCTTTTCTTATGAGACGGCCCTTCACCGTCCCATCTTCGACCAACTGACCGGCCCTCCAGACTTCCCTCTTTCACCCATTTC
TCTTCT