Description :
From Genome Similarity Track
Location :
Scaffold_384:1- 7492
Transcript NameFunction/comments
g13792.t1hypothetical protein

Sequence
7491 bases(100 bases per row)
TTGTCTTCGCTGGTAGCGAGAAGTGCCCACCCGGGGCCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCCTACAAGCTATGCCTCTTGGGGAACGAC
GGCAGACATAATCCAGCCCACGCAGGGACTTACCGGGAAAGGGTACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCGG
GAAGTCCCTTCGGGCTCCCCCCTTTGGTCTCCTATCGATCCTATACAAATACCTAGTGAAATGGAGTCGTTATAGATCTCCCTGCGACTCTTCGCTCAGC
TTCCTAGTTGATCTTCGCCGAGTCGGGTCGTTATGGATCTCGGCCGACCCTTCGCTCCGATTCCTGATTTATCCTCTCCCAAATGGAATACGCTCGCTGA
GTCGCTGAGTCTTGGTGCTCGCCGAGTCCGACCGATTCGCCGAGTTCGCCGCTTAGGTGCGAACTCCGATTAGGTACGACGTACTTAGCTGGGCCAGAAT
GGGTGGTCTACCCAAAATATGAGTTTCCCTACACCACAACTGCCCCGGGCGTGATACGAGCCAGGCTGGTAAGTGTCTCGACAATCATTCAGCTCCACAA
TTCTCCAACCGTCGGAACTTCGTTCGAAATCTCGTTACCACCGGTTCACGAGCTCCATCACCTTCTTCCGGCGACCAGGTGCGTACTGTTGCCTTCTGCG
CCACTTGCTCATGTTCATGACGTGCTAATATCGCTCTCCTGTGCTTCTGGTAGCTTCTCGTTAAATCGCTGCGCTCATCGCCGGTCCTGTTGACGTGTAC
ACTCGCTGCGTCTCGTCCGACTTAATTGCTGTAGCGTTCGGCCACGTTCGTCTTCTCCGGACCTCTGTTGGTTCATCGCCGAGTCTCTTCGCGGCAGATT
TACGTTGTCGATCTTTTCGACGACTCGCAAGCATGGTGCATTCGCCGAGCCGTGCTGGACCGCCAGCTGCGCTGGCTTTTGTTGCTTACTCGGAGGACTC
GTCGACGCCTGGTAGAGCTGAAGCTTCCGCTCGCTCCCATTCGCTCAGTCCGACGACTCCTCTTCTTGATTTGGCTCGCCTCGCTGGGTACGACTCGTCG
AATCTCGCGGCAGGCGAATTCGCTGGCCTCGCTGAGATTCGGCGCGTGCTCACCGAACATGAGGAGTCCCAGAAGCAGCGTGACGCCGCGTTGGCCACGC
TCGTTTCTCTCCTCTTGACAAGTGCTCCTCTTCCGATGATGCGTCGTAGCGCTAATCCATCTTGGGCGCTAATTCGCTCGCTGACATACTGTTGGCTGTG
AGACAAGACGTGGTTCCGCTTCCTGACATGGCTAGCGAGGTCGCGGACATTCGGACTAAGCTCGCCAAGTCCGAGCGAGTCGCTGCCGCCCGCCTCAAGC
GGATGGAGTCCGCTATCGCTGAGTCGGCCACCATCCAACACCGGTTGGATACCGCTACGCACGAAACAGCGAAGTGGAGGACAGCATCCTGAACTCGTCG
AGTTCTTCAACAAGACCATCCTTCAGCTTAAGGCTCAAGCTAAGGTGGACTTGCAGCTCGAAACCGAGTGAACTCAGGCTGCCGAAAGGACCATTTAAGG
TCTCGACGCCGAGTTAGCTGCTCGAGAGCGGACCATCGATCAGCTTGGTCGACAGCTCGTCGAGGCGGATGCTGCGCAGACTGTTCTCCGCGGGGTGGCG
ACGAAATACTTTCGCGACGCGCAGGAGGCTGCCGTCTTGGCGTGTTCGGGTGGTGACTACGCTCTGGCTAACGCTAAGCGCACCATCTCAAGACAGGCTG
AGGTGATCTTGAGCCAGAAGGCTGTGATTCGTCACAACGGCCGTTATCCGGTGCATGACCCCACTTGGCGGTTGCTGCACTTGTTGGAGTTGACGTGCCT
GGGCTGGATCCGCGGGATATTCATCTGAATGCTCGGTTGTGCCGCATCCTCGCTGAGCGCTTCCCAGAGTCGATTGAGCTAGCCGGTTCGACGAGTCCCA
GCGAAATCACTCTCCGGATTCGCCCGATCAGCTCGTCGATTCAAGCTTCTACCAGTTCGCCGAGCGGGTTTCAGTCTAACTCAGCGGGTGTTGCCCGGCC
GAGCTCAGCGAGTGATTTCCCACCAAGCTCAGCGAGTGCAGCTTCTGGTACTCTATCCGGTCGTTCTCGTTCCACACATTCTCGTCGCCAGTCGCGTCGT
CAAAGTCGTCGTTCGGTCTCCCAGTTGCGGAACGCACCACTCCGCAATCTGACCTCTTCGGAGCGTCTTCGCCGATATGCGAATCCTGCTTCCCCCACAG
CTGCTGATCCCCGTCGGAGTCGTTGGAAGAGTGTTCCACGTGGTCTCTACGAACGTCCGGTTCCTGGAGAAGAGGGTTTCGACACTGCCACAACTTTGCT
CAGTGCCGAAGTGATCGATGAGTTTTCTCCTTCTCTTCCGATCCCTGGTCGGAAGCGCCTCCGAGCTCCGGCTTCCAGTCTTCTCGCGCTTGGTTCGTCT
GGTTACCGCCCTCAGCGTCCTTCGCTGAGTCCATCGCAAAGCCCCGATCCGCCAACGACCACTGACTCTGGCAAACCTTCTCCCGAATCTCCTAGTACAG
CCGATTCAGACATGGCCCGTTCGTCGGTCGTGTTGGCGAGTTTGTCCCAGGCTCAAGTTACTGTTCTTGACAGCTCCAGCTCCTCTTCGAGTTCGGCTTC
TGTGTCCACGCAGCTGTTGGACTCGTCGAGTGAAGATTTTTCGTCGTCACACTCTCCGAGCTCGTCGAGGGACATTACAGCTGGATCGCGTTCAGTCCCG
GCCCGCTCGGCGAGTTCTGTCGCAAGCACCTCTCTCAGTAGCTCGGCGATAATCGTCTACTCGCCTCCTTCGGTTGCCCCAGCACTGATGCCTTTTCATC
CGGCGACTTCGCTTCGACGTCGTCCATCTCGAGCAGCTGCGCGTAATGCTACATGCATCACGCATGCTGTCCTCGAGGAGCTGGACGCTGCAGACGATGA
TGTTTTGGGGACTGCCGCAGCACCTTCCGTCTCGTCGAGTGAGGTGCTGCCTCCTGTTCCGGATGCTGGTGTGGTCGCTGAGTCTGATGACGATTATCCT
TCGTCAACGAGCACCATGGATCTCTCAGCTCAGCGAACTCCACCTCGCGGGAAACTTCAGAGTTACGCCGATGCTCGCCGAGTTGTCCCGTCAGTGGTGA
AGCGTGGTTGTTCCCCTGTCGCTTCCACTAAGCCATCTCGGAAGAAACGCGCCGCCCCGGAGATTCCTCGCCGAGCTACCAAGAAAGCTAAAAACTCGGC
GAGATCTCCAGCAGCAGTCTCTACGTCGACAGCTCCACGAGAGGCTCCGAAGGGACGGGTTCAGAAGGCACGACTTCGATCATCGGGAACGGCGACAGCT
TCCTCGATTGCTCCGCAGTCGATTAGCTCGCGAAAGGTTCGCTCAGCGAGACCATCCGTGGCCTCGCCGAGTACCTCCACACTCTCGGCGAGTATGTCAG
TCGTCGAATTACCTCCAACTCTCGCTCTGCCACTCGCGAAATTGCGTGCTCGAGCAGCACAAGCGATTGCTCGAGAGGCACGCGAGACTCCAGCAATGCG
CCAGACTCGCGATGTGGTATTTTTCCACTATGGTTCCGCTCGGTGCTGGGCGAAAATTACTGCTTGTCGATCTCCAGTGACAATGGAATACATCGACGGG
AAGCCTCAGATCGTGTCCGGTAGATGATGAAGGTCTTCGACTCGTCTCACCCTTGCCAACATGTTCTCGCTAAGTTCCCAATTTTCGTCGCGGAGAGTGC
TATTGACTTGGCTCGCCATCGTCTTCACATGAAGAAGAGGTCAGCGAAATCCACTGACCCTTTGGCCATCTTGTCTGACGCTTGGACCCGATTCCTTGGC
GATTCACGAGAATTCGACGAGGCTCAAGACAATGATACTCGGACGAAGATCTTTGTGGCGCTCTGGGAGCGGAACCACTGGTTGGTAAATTCGAGCGTGA
TCATTGGTTTGCATCCCGATTTGAACCCTGGTCGATTGGTCGCCGAGCTCCTAACGCTGTGGCTTTCGTATAGCACCGAGCGTAAACGTCGTGGGGACTT
GTTGAGGCTTGTGATGAAGTCTCTTGAGACGGTCCTCCATGAAGTCGTGGCGACTCGTTCAGCAGCTGGTCCAGCACCGACTCTCGACCCGGAGTTATAT
TTCGAGCCAACTGTCCCGATGTATGCTCTGGTTAATCAACCGTGGTTTCCTACACGGTCCGATTGGCTCGCCGAGCTCGACGAGTTGGATGACCAGGAAC
CGTGTCGAGTGTGGTGGCTGACTCATCCAGAGAAGCACCCGTATAACACCTGTTTCCGCCCGCGTAATCCCGAGTTTCCAATGTTTGCTCCCGAGGGTGT
CCCGGTTGGAGAGATCGATCTCGATCTCGAAGAAGATGTGGATCAGAACGAACCAGACCCTCTAGCTGTTGACGGAAGTGCACCTCCTCCTGCTAACCGG
GCGGACATTCACATCTTTGAAGGCATTTTCGATGAGCCGTAGGTCGGCGAATTACTGATTCTATTTGGTGTTCTCATCGGTGAGTTGTCTCTTATCGCCA
AGGCCCATGTTCTTTTAGTCGCTGATTTCGATGAGTCTTGGTGGTTCTTTCTTGTTTCTTCGTAATCCACACTTCATCCATTTCGTAATATCAATTTATG
TAATGACGCAGTAGCATTACCCATCCATCCATCCTGCCTGCTGTCTTCACAGGTTGGTGTTCAATCTTCGTATGCAATAGCATTTAACACTCGTCTGCAA
CTTGCACCAGTTGCAGACGGTTTTCACGTTTCTCTGGCGAAGGTAATCGAACAGAAGGCCTCCGCACGATAAATTCGACAATGGTTCCCACGTGGGTTCA
TATCCCACCCATTTTACTTTGAACAGACGCTGAGCTCGGTCGGTACTTGTCGAAAGCGGCATTTCATCATCGAGAATGGCTTCTACTTCGTATCGCCCGG
TTCGTTCGTCAGGTTCCCAGCTGTCTTCCGGCAGCAACTCCTCGTCGAAGTCAAATCGATCGTTTTCGCTGAGACCATCGACTAGCTCAGTCGTGGGACG
TTCGCTGAGCTCAGTCACCTTCTTCAGTCGTGATACATGAACCACGGGGTAGAATCGATAGCCACTCTTGTCCGGTAGTTCTAGATCGTAAGCGAACTCT
TCTATCTTGTGCTTGATCCGGAAAGGTCCATGCCACCGGTGCGCGAGTTTCTTCTTCAATCCTGATTTCACCCGTTCCATGAACAACCAGACTTGGTCTC
CTTCTTTGAATAGCGACCGCGTAGACTCAGCTAATTCTTTGTTCGCACTTGCAGTTGTTGTGTCGTCTCTCGCTGAGTTTGTCTCGTCTACTTGTCCATT
GTCTTCGTTACTTGTTGAAGGAACAGCTCCCTGTTGTACTCGGCTCAACGATTCGTTATGCTCTTTGGCTCGCCGGGCTTTTTCTTTCAGTTGGTATTCC
TTGGCAAGAATGAGTGCGATTTCTCGCTGCCGGATTGCTTCTCTGCGCCATTCTATAGCGTTTGCTGACGTCGTTTGTTTCGCTGGGCTTTTTGAGGCCC
AGCGAATGGATGAAGTCATCGATTTGAGTGTAGACTGAGCATCCCAGCCGTGTACCAAGTAAAATGGCGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTT
GATAGCGTGGACGAGGTTTTCAGTGATATCACCCCAGTCAGCTTGTAACGGGTCTTCTACGTAGACTCGTACTGTCTGGATCATCGTCTTGACGCTACGC
TCTTGTTGACCATTTGCTTGAGGCCGATAACTCAAAGTGGCTCGAGACTTAGACTGCATCATCTCGTAAAACGTCTGGAAGACTTCACTCATCAATCTTG
GATCTCTATCGTGTCGAAGGAGCGAAGGAGCTCCAAACCGACGAAAAATGCATTCTTCAAATGCCTTTGCCACCCCAAGTGCCCCTGTGTCGCTCATTGC
CTTGGCGATCACGAATCCAGTAAAGTGATCCTGGAAGAGGAGCAGTACGGTGTTCTTTCGCTGAGTCTTTGGCAGTGGTATAAGGAAATCCATCGACACG
ATCTGGAATGATCTGTCCGATACTACGTTGCCTGGCGAATACCCTTTTAGTTTAGGGTTTTCTCTTGCTGGTAGTGCAGTCTTCGCATGCTTGGACGTGC
TTGACCACATCGGCATACAATCCGATCCAATAATAGTCTGTCTTCACCCTGTGATACGCTCTCACGATACCTTGGTGCCCTCCCTCGATGGAGTTATGAC
AATTCGCGAAGATTTCGTCGATGAGCGTGGTCGGAACTACCAGTCTCAGCTTCATATCTTCTTCGCTGGGTTCTCTTCGCTCTCGTCGGCGACCCAGATA
ATACAGTAGGCCATCTTCGCTGAGCACGAAGCGGTCAGCAATTTTGCCTGCGTTTCCTGCTCTTCGTCGAGTGAGCTCGTCGAATACACGTCGCAGGTAT
TGTTTCAGGTCTGAGCACTTGTATTTTTCGTCTTGTGCTGCCGATATTTGTTCCCGCCGTTCTGTCTGAACGGCGAACGGATCAATGTCCTGGGCGCTTG
GTCACTCTTGTCGCTCAATTGTAGTGTAACTTTGTTCAATCACTCTTTGAGTTCCTGGAGGCTTGTACTTTTCTTCGAACTCGCCGTATTTATCGCTGTC
ATCGGTGAGCCTTGGCGAGTCGTTTCCTCTTAACGCTACTGGCGTTGTTGGTTCATTCGCTGGGTCGTCTTGCTCATCCCCGGCGAATCTGACTCGGCGA
GTCTGACGGGCTTGGCTTCGTGTGGTCGCTGAGACTTTAGGAATCTCTTCTCCTTCGGTTAGGTCTGTGACGGCGTACAGCTTCTCTTGGATCCGGTTTA
GCGTTCGCAGTTCTGTTTTTCGATCTCCACTGAGGACAACGCGTCCTGCCATGGCTTCAAGAGCTTCAGTGGCTAATGCATCTGCGGCCGAGTTATAGCA
GCGGACGACCTGCAGGTAGCGGACTGAATTTAGGCGTTCGACGAGTTCTTTGTGGCGTGCTAGTTCCACTTGCAGGGTCATGCTATCACCCCCATGGATT
GCTGGATTGCGAGCCTGGAGTCGCCCACAATGATCAGGTCAGTCACCCCTCCTTCCAGTGCCGCGAGGACTCCGTGGTTCATCCCGGTGTACTCAGCGAT
ATTAACTGTTGTTGACGGCAGGTGAGCACTCGCGGCGATCACAATGTCCCAATTCGGTAAACGCCACAAGATCCACGAGCAACTTCCATAACCGCCGTAT
TTTTCGGTCTTCGCCGACCCGTCGAAGTCGCGCGGCACGCGCGCGTACAGCAACTCGGGATCCATTCGGACACTCGCCGAGTTCTTAGGCATGGGTGCAA
TGTGAGCTAGTGACTCGTCGAGACCAATGAAAGGATTGATCGAAGCCTGTAAAAGCTGAGCGAATTAGACGTTTCGTTCACGTACACGTTT