Description :
From Genome Similarity Track
Location :
Scaffold_1107:1- 7312
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1107-snap-gene-0.4Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1107-fgenesh-gene-0.250S ribosomal protein L4
Pytiw_DAOMBR242034maker-piw_contig_1107-fgenesh-gene-0.0Protein pianissimo A

Sequence
7311 bases(100 bases per row)
GCGATATCTGCGACGTCTACACGCAGAGCGACCTCGAGGACAAGTGGAAGGAGCTGCTTACAGTCTACGACGTAAGTGTGCTCATTCAATTTTTGATTCT
CCGTGTGAGCATGTGACGCAACTCGCTTGATGCTAACAAACCTCTCTATGGCGCTCCTCCTCCAGCAACGCCGCAGTGACGACAACTTGAGAGAAATCCT
GGCTCTGAGCGCGCCGACCAAGCGCGTGAACGACCTGAATGGCTGGCATCTGGAGCGCATGGCGGTGGGCGAGTATGGCGACAGCAGCGGCGCAAGCAGC
CAAAGTGACATCGCTGCGATCAAGCGCGACGCGCGCCAAATGAAGCAAATCGTGAGAAAAGTGCTGGCGAATGGGCGAAGCTTTCAGGCGCGAAGAGATG
CGCTTGTGGATGCGATGACGAAGCAGCGTGACGTGCTCACGAAAGAGCTCGATGCCGCAAAGGAGTTTCTCGGACAGATCCACCTCTCGGGGGTTGCGTC
TGACCCTGCCGCCATCGGCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAGCGCCTGCTGGCAACGGTGAAGGCTCCGGAGGTGTCTGCGAGTGTGGATCTGGGTGCATTGCCGTCTATTTAGCAAGTGT
GACAACCATCAGTGAAAGCTCTGTATTGTTCCCTTTCTCCTTTTATTCCGTCAGGTTATCCTCAGTGTCATGTGTGCGTGTCTTCTCAGTCGCCGTCGCA
ACTGAGAAGCGCTCCATCCCCGTTCTCTATTCGTTGACAACACCAGCAGTTTACTCGGTGTGCAGGCGCTCCTCCAAGTACTTGACCGCGTCCTTCGTGA
TCACGAGCAGGTCCTTCTGGAGGATCGAGTAGACGTTGATCTTGTGCTGCGGAAGCGTGTCGACGTACGGGATGTTGCGCGTCGAGAGCAGAAAGTTAGT
GGCCACTTCCTCGCTGTCGATGAAGAGCGCGTGGTCCCAGCCGCGGGACTCCAAGAACTGCTTCATATCCTTGGTCTTGGAGCTCTGTGTTTTGAAATAC
AGAAGCAGCAACTCATCAGCACTTTGCGCTTTCAACCATGGTCAGGATTTGCATAAAGACAAGCAGCAACATACCTCAACGTCGAGGGAGTCGACGATGG
CGAGCTTTCCTTCACGAAGCTTGGTCGAAAGCGCAACGCGGAGACCCATGGCGCGCACCTTCTTCGGCAGCGAGTACGAAAAGTCGCGGAGCTTGGGGCC
GTGGACACGGTAACCACCACGCCACTGCGGCGCACGGATGTCACCGACACGCGCACGGCCGGAGCCTTTTTGCTTCCATGGCTTTCTGGTCGAGCCGCTC
ACTTCCGTGCGGGTCTTGGTCTTGTTCGTGCCAGCACGACGGCACGCCAGCTGCCATCGAACGACACGCTGCAGGATGTCGACACGGGTTGGCGCACCGA
ACACGCTGCCGTCGAGCGTCACCGGCTCCAGCTCATCCTCGGACTTCAGGCTCAACAAGTTGATCTGCACGTCGCCCTTGGACGTGAAAGTCACTGGTTG
CAGGTGCCAAAGAGACGCATACGATAACGACATGAGCGACACTGACACTGCATTACAGCAGAGAGATAAACACTGCGGACACTGAATTGCAGTCCGTAGA
TCAAGCGCGCCATACCTTTCTGCGCGGTCGGGATAATGCGAGGCTCGCGCATTGGCTTCTCCTCGGCAAAGACGATGTTCACCGGGATCTCGACAGCAGG
CTGGGAGCTCATGGCGCGCGCGATGAGCGCAGAGCGTGGCGCGGCGCCGACGCTCATGGCCGCGACGCCGCTGATGAGGCGGTTGAGCGCGAACGACATG
GTCAGGAGCTCACGCGATCTCTCCTCTCGTGCTGCGCTGTGGGGCTTCCTCTGTCAATTGCAGCGCGCGACCAGCAGCCACTCAGGCTGGAGCCACTAAT
TGAGTCATGTCCTTAATATGGAGTGTCACTATTCAAGAAAGTCCTTATTTGTGTATATACTGTTTAAATGAATACCATATTAGAGAGGTCTTCGTACCAT
CACGATTCAAAAATGAATTGCTCACGGGGAAGTCAAGCCATGATCACGAAGACACGAACGTGGACAAAGCGGGCAACGCACTCAGCAGCTTCTTGAGAGA
GCGGTCCGAACCGCAGCACAGCTAGTTACCAGGAGCTTCCGAGGCTGCCACGAGAGAGAGAGCGCGACAAGATGGCGCGTCGCATGTCGCTGATGCCCAA
GTCCGCGGACTCGAGCAGCCTCGGCGCGATCTGCACGCTCATCGAGCGCGGGAACCTCGACCGCAAGTCCAAGCTCGAGAGCGCTGGTCGCATCTGCCAT
GTGAGTAACTTGCTGTCTACGACAGTGCTCGTCGTACTTTGCTATCAGGGGGATCGGATGGCAGTGTGAGCTGCGGTGATCATCCCAGCTCGCTGCTACA
CACGGGGAGTTCATTCATTTGTTGTGCATTGGTGCTAACACTGTTGTTATATGTGTAGGAGCTGAAAACAGACCCGCTGCTGCTGGACAGCTTCCCGATC
GACCGGCTGATGAAATGCATGCGGCGGCTCGTGTGTGACTCGGACTCGTCCACGCGCTTGGGCGCGCTGCGTGTCCTGCGCTACACGATCTGCAGCAACG
ACAGTGTGAAGATCCTCATTGACCTGGTACGAAAAAAGTCATTTGTGGACAGGTGTATTTTCTCTGCTTATGCGCCTGGCGTGTGGCTAACGTTGTTATG
TGTGCTGTGTACTTGCATCCATTGAAGTGTCTTCCCATTTTCATCGTCCGAGCTATGGAGAGAGAGCAGAAGCTCCTGGCCGAGCGAGTGCAGGCGCTCA
AAGTCATCCGCCGCGTCATGGAGATCGACGCCGCGCAAATGCCACCGAGCTTGGTTGCGTCGATCGTCGCCATCGCCGGTCACAAGGATGACAACCTGCG
ACGTGTTTGCCTCGAGACGCTTCGTGAACTGGCGCTCGCGAACGTCGCCATTGTGGCCGAGTGCAATGGCATCAAAGTGATTGTCGACTCGATCCTGGAC
TCGTCGTTCCAAGATCTGTCAGACTCGCTTCTCTTGACGCTGCTGATGTTGCTGAACGAGCCTTCAACGCGCCAATTCATCGACCCGTTTATCGACACGC
AGATCTTGCTCGCGCCGTTCACAGACACCGATGTGCCAGCTGGGAACGAGAGACGACAGCGGTGGATGGCAAGTCGGAACGCTATTGTGACGATGATGCG
GTCGTGGACGGTACGATTGCGTTCCTGTGCCAACATTTGATGCTGCTGAATGGTGGAAAAACACCTTCTAATTATGCTGATATTGCTATGTATCACTAGG
GTATTGTCGTCCTGACATCTAACCCGCAAGGTCTCCAGTCGCTGGTCCAGTTGCTGGTTCGACCTGTCGGCGAAGATGTCCAGAAAGCCGTACTCTCGAC
GATCTGCGAGATTTTCTACAAGAAGACGTCGTTTGACAAGAGCGCTGCCGATGCGGCTGACGTGGTGTCTGCAACAATTCCGATCAGCGTCTCCTCGTCC
GACGCCATTCCGGCTCCAATGGGATACAATCTGCTCGACAATTACACTGTCATTGTGCTTCTCGCAATGATCCACTGCGGGCTGCTGGATGCGTTGATCA
CGCTGGGAACGGGAACCGTGCGCTCGCTTGCGGAGCCAGCAATCGACTTACTCTCAGACATTCTCCGGATGTCGTCAAGACTTTTGCCGGACCAGCACTG
CGCGTCACTGCTAGCACTTCCTCGACTCGTATCGGCGACATCCCTTGCGTCCATGACGACGCAGACTCTCGGAGATCAAGTGAAGAGTTTGCTGGAGCGT
CTGCAACGAGAGAAATCGATTCGGGCAAGTGAGATGCTTGCTGAGCTTGCCAATGCCGTCGGCGCCAACTCGGGAAGTATCGCTACGCGTGGCGTGTCGC
TTGTATCGTACGGTGGAAGTGGCGTCAATGGTGTCCAACTGGTGTCCGAGTTACTGCGCGAAATCAACCGCCCGTCGACGCTGTATTTGCAACTCGGTCG
TGCTGGCAGCACTCCGTCGTCGAACTTCTCCTCTTCAACAATGAGACGCAATGGACCGTACTCTGGAAAAGACAACCTTACGTCTCGCGAGCTGATGGTG
CAGGAGCTGAAACACTCGATGGACGCGCAAATGGACGACACCACGTTCAAGGACATGCTCCATAATCGGTCGAAGATTTTGACAGACAAGAACTTCACCA
AATGGAATTGGGACGTGATTTCCGAGATGCTGGAAGGACCTTTGACGAACCCGCAGCGACTCTCGGAGGCGATGAAAACCAAGTTTTTCAAGCGGCTTTC
CGGTTTTTTCCGTGGCGACACGGGCAACAAAGGCTACTTCTCGCTGCTCGATTGGATCCCAGACAACGTCCCGTTCCTTCGACCTGCGTGTCAGATGTAT
ACGCTGCTGTTGAATCATCCAGAAGGGCTGTTGTTCCTGAAAACCGATCGACGCGGTCAGCTGCTGACTGAAATCTCGTCGGCGTTGGAGCTCGAAGCCC
GTCCAGAGGCTGCAATCGTGGAGTCTCATATCGGCATCTTGAAGCAGCGCATGTTCTCGCCAGTGTTCTGCTCCACGAAGATGTTGCGCGAATACTTCAC
GCTTCTGGGATTGATGAGTTCCAGCAAGGAAGGTTTGAAGATGATGGAGCAGTCGAATCTCTTCAACCGTTTGCACGTGATGGGCACAACGAAGGGTCAT
GACTTCCTGTGCCGCTTGATCCTCGCAAACCTGGACTACTCTGTGGATGGAAGCTCTCGCAAGCTGCTCCAATCGTGGATGACGGAAGGCTCGAAGGCGC
TTCGTCTCTACGCGACGTGTCTGCTTCGAGCACTTTTGCGCTCGGAAGTGACGGATTTCGCGAAATGGGGCGTCGATGCGCTTGTCACGCAGCTGACGCA
GGAAGAGGAAGTTGCGAAGTCTGCGCTGAGTGTTCTGGAAGAAGCGACCGAGACAGATGAGTGCTTGCTGGCGATGGTCATCCGACGTCCGACGAAACTG
ATCCAGATGAAGGATAAACGCGCCGAGTCACTGCTACTGAAGTTCTTGTCGCTTCCAGAGGGACTCGCGTTTTTGCAGGGAGCTGGCGATTGGATCCCAC
GGACACTGGTCGCGTGGAGACGTGAGAAGTACATTTCGTACGTCCATGCAGTCGAGAACTCGCTCTTTCGAGGTCTGCATCGTGACGTATCCGGTCGAGA
ACGAAGCACACTTTCCAGTTCCGGAAGTATGCGAAGAACTTGCTGGCCGACGCCTATTCCTGTGCAGGTGCCGATGAAGCGTGGCGGCACTGTGAAGAAC
GGAAGCCAGCGCTCGCTGTGGGGGCTGGATTGGCTGTACAAGATGCCGTGGAACATGGAGGTGAAGATTGTCGGACCTCCTGGTAGCGGACCTCCATCGA
ACTTGACCGTTGAGACGTACATCGACGGTTCGTTGCGCGATGAAGAAGATAGCGCTCTGGACGAGGACGATCTGCGAATGAATTCGATTCGTGTGAAAGC
GATCGTGGTTGATGCCCGCAACATGCCGCAGCCGGTGATTGTGAACTCGCAGCAAACGTTGCAGGCGTGTCTCTTCTTGGGCACGCAGCCGGTGGACCGA
CGTGGATTCACAAAGCCTCCGCCAAAAAGCAATGGAGGATTTGTGATGCCTCCTTCTGTCACCGGCACAGATGCGCAGACGAAGGGTCGAACGCGTTCGA
CGTCTGCAGCTGGAGGCGGCGACCGCTCGTCCGAGACAAATGCGAGTGGCGCCTATGGTTTTGCTGATCCGTCGTATCCTGCGTCCGAGTCTGCCGCTGA
GGAACACAAAGACTGGAGCACGTGCCAGCCTGATCAGCGCTCGTCGCAGTACCTGACGTCGCCAGAGTGCTCTATTTGTGCGCCGGGTGAGCGAGCCGTG
TGGAATTTTCGTGTGGAGATGGACAGCAGCACAGGTGGCGTGAAGCGCTTGATGCTGAAGTCTGTCGAATTTACGCTGCAGCTACTGCCGCTTCGCCCTC
GCTCGGTGCCGCTACCTCCTCATCTGTACGGTGAGCTGGGCAAGACGAGCGCTGGGTGCCAGATCCTGCACACCTCTGGACACATTCCTGAGTTCATTGC
GTGCCTGCGAGACAGTGCGAGTGTTCCACTGGAGAAACGTGCGGCGCTGTGGGCGCTGGGGCACATTGCAGCGACATCAAGGGGCTACGATCTGATCCAT
CACTACGCTCATGATGTACTTGATATGATCGTGAAGCTCACGACGGACTCGCCGCTAGTGTCCATCCGAGGCACGTGCTTCTTCGTGCTCGGCCTCATCT
CTCGCTCGACGTCTGGACGTCGCAACCTGTCGCGTCTTGGGTGGGACGCAGCGAACGTCTCACAGTCGTCGATCTCGGTGCCGCAGAATTGCAATTCTCT
GTTTGTGTGGCCACGTCCCCCCAGCACTGAAACTGTGAGCAAGATCAGCCCCGTGACCCAGAATCCAACGTCGCCGCTGCAGGTTCTGCTCTCGAAGGTG
CCACCCGAGTGGAGGGAGATCCTGCGATTGGTCGCGGATTTGAGTAACCACATCACCCAGAAAGAAGCACATTCGTCGCTCAACAAGCTCCGCACATCAA
AGACCGAACTGTTTGAAGAGCCGATGCTGGCACTCTACATCCACGCGCTGCTGGAGAAGTACAACTTTCGACTGGCGTTGCGGCAGTTTGTGCTCAACGC
CTTTGATCGAGCAGTGCTGACGGACGAAGTGCTCGAGTCTCTTCGCGACGGGTACAAGACGAAGACTGGCGTGCGCGTGCCACACCCACGCGAGTTGTTG
CGCCGCAAGTCGTCGCCGTCGATTCCGTCGTTCACATCATCGATCCAGAGCCTCAACTCTGCGATCCAGAACACTGGACGCATGTCGATGGCCAATGGCA
CGAGCATGGGCGGCGGCGGTGGACAGCCGTCCTTCATGCTGGCTCGCTCGTCGTCGAGCTCGGGGCTGGGCATTGCTAACGACGGGCGGTCCACGTTCCG
AATGAACAACCACGACCCAATCGACCGCGCGGTGTTGCTCAAGCGCAACCGGAAACGCGTTGCGCACTCCGAGAAGACGATCGTGGTTGGCGCTCCAGAA
GCTGTCGTGTA