Description :
From Genome Similarity Track
Location :
Scaffold_903:1- 7069
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_903-abinit-gene-0.12Dynein heavy chain

Sequence
7068 bases(100 bases per row)
GCGGGCGGCTTGGACATGGTCTTGCACTCGCCCAAGTCCTTCTTGTTGAGCGAGTCGAGCGCCGCCATGGCCTGCTCGACCGCCGGCTCGGCCTTGGCAA
GGTCCTCCATCGTTGACCGCTGCTTCTCGATCACTTCGGCCTGGATGATCGCACACTTAGCGGCCTCCTCACTCGCCTTCTTGCTCTCAACCTCGACGTT
TGCCTTCTCCTTGTTGACCGTCTCGGCGATCGCAGACGACACGGCTTTCTTGTCCTCGGCAGCCTCGAGCTTGCCCTTCAGCTCGACTTCGAGCCGCGCG
ACGGTCTCGCCAGTCTCCTTGAGTTTCTGCAAGCCCTTCTCGAGTCGCTCAATCGCCGCCGCGTACTCCTTGACCTTCTTGCGCAAGATCTTCTTGTAGA
GCTGCAGCAACTCGAGGTACGACTTGGGCGTCGTATATACGTACCGGCGCTCGACGAGGAAGTACCGGTCGGCGCACTGGTTCACCGACGTGAAGGAGAA
AGGCATGAAATTCTCAATCCCAGCCCGCGAGTCCTCCGAGCCCAGCAAGTCGGCGATCTCCTTGAGCTTCTCACGACCCACCGATAGCAGCGCCTCCTTC
GGCCACGGCTGGAACCAGTCAATGACGGTGCAGTTGACCAGCGCTGGGAACTTTCGCGCGCGACTTCGGAAGTCGTCGCCCACGGGCGAGAAGCAGAGAC
ACAGATGCAGGCGCTTGCGGATCTCGGCCTGAAAGAACTTGACAACCTCCTTCCGGTCCTTGGAGCCGGCCACGGGCGACAGCAGGTTGACAATGTTGTC
CACGTCCTCCATGGCGAAGAGGTCGGGGACCTCGCCCGAGGCGAGCAGGTCATTGAGGTAGATGAGGAACTTCTCGTTCGTGATCTGCGAGTCCGTGAGC
ATGAACACTATCCCGCCGTCCTCCTCGCCGCGCGAGAGCATCTCGACGACGTTCATGTGCATCTTGCGCAGGTCCTCCTTGAACTCGTTCTCGCCGTATT
TCGAGCTGATCGTGATCTGGCGCACGAGGTAGCCGCAGATGTGCGACGCGAGTCGCGCGAGCGACCGCTTCCCGCTGCCACCGACGCCCACGAGCAGCGC
GTGGCCGCTCTCGTTCCGCAGGATGCGCACGATGCGCGCGACGTGCTTGACGGCGTCGTCGAACAGATCGAGGTGCATCGCCGTGTTGTTCTCGTTGTTG
TTGTAGTCGCGCAGCTGCGCCTGGAGGTTCATCTTGAGGTCGTCCAGGTTCGTGCCCATGATCTGGTCGTACTCCGAGTCGCCGTCCTTGGTGAAGTGGC
AGAAGATGAGTGGCCACGAGTTCTCGGCCGCGTAGTACCGGCTCGTGTTGCACGCTGGGAAGGAGCGCTTGACCTGAAGCTGCACGAGCTGGTTGTACTT
CTCAATGTCGGCCTTGCACACGAGCCGGTCGCCGTACACGCGCTCGCTTTCATGCAGCCAGAGCAGCACAAACTTCTCCGTGGCGGCGAAGCGCTGCTTT
TTGGACGCGATGAGGCCCTGGAAGACGTTGGAGAGGTGGCGCACGTTGAACTCGTAGTGGAAGTTGGCCGCGGTCTTGCGGAACGTGTTGACGACGCTCG
TGTGCAGACTCAGCGCGGCCTTGATGAGCGCGTTGGAGAACTGAACGTTGGCTAGCTCGTCGGCAAAGCTCGAGAGGTGGCCGCCCAGGAACGTCTCGTA
GATCGTCACGAGGCTCGGTGCCTCGGGCATGCCCATGGCAAAAGTACAGAAGTGTCGCTGCAGCCGCGGGTCGATGAGGAACGAGCCCGCTGTCGGGTTC
ATGCCGGCGACGACCTGCGTGTTGAGGATGTTCTGCGTCTGGAGCTTCTGGCGGTCGAACCAGTGGTGGTACTCCATCACCTGGCGCAGGAGCGAGATCG
CGCTCTGCGTGTTGTAAGGGTCCACCTCGGGCAGGTTGACGTCGTCCATGAAGTAGATGAGCTTGGCCTTCCCAGGTGGCCCCATGTTGATGCCAGTCTT
GCGCTCGAGTTGGCCGAACATGGCCTGTTGCAGGATGCCCGACGTCGTGTAGAAGTTGAAGTTAATCGTGCAGTACTTGAACGCGGCCGTGGCCTCGTCC
TTGCTGAGCTTCTTGAGCATGCCGACGATGTTTTGCGTCTTGCCCGTGCCCGCGGGCCCGCAGACCATGATCGGGATGCTCTTGGCGATGAGGTTCTCGA
GCCAGAAGGCAATCGACGCGGTCTCGGTCGTCGGGACCGTGATCTGGTTGATTGGGCTCGGCGACTTGTACACCTCCGTGTAGAAGTACGGCGACTTCGC
CCACGAGCTGAACTTGGACGACTCGGGGTCGAGCCAGAAGTCAAAGACCGTGTTGCTCGCGGACGCCACGAGCTTGACGTCCTTCCACTGGTTCTTCCAC
CAGTTGCTGAACTCAGCCGAGTAGTCCGTGCCGTCGTCGCTGAGCGTGAGGATGGACCCGAAGGACCAGACGCAGCAGAACACAAAGTTGTTTTGCATCA
CGGCGTAGTCCTCGAGCACCTGGGGCGTGAGCAGGCAGTCGACCATGTTGAGCAGATTGGTCACGAGCGTCGTCTCCTCGACAGGCACAATCGGCACGAG
CTTCTTCTTGAAGAAGCGCAGCGTCGGCTCAATGTACTGGTCGAAGAGGCCCTGGAACTTGGCGCGCACGTCCGGCGAGAAGACCATGTTCTTGAGCCGG
TGGTCCACGGGCACCTGGCAGTGGCGTTCGAGCCAGCTGTCGATGAGGCAGCGCCACTGGTAGCCCTCCGAGGTTGAGATGTAGAGGATCCCGGCGCGCG
AGACTGTCGCGGGCGTCGCATACATGAGATCGCGGATCTCAAAGATCATGCGCATGTGGGTCTTGAGCGGGATGCGCTCGTTCGAGGCCAGCGTGAGCAT
GCGGTTGTCATCCATGACGGAGTTCATGGACTCGATCCAGTTCGCGTCCAGGTCGCCGTCCAGGATGATCCACTTTGGGTTGTTGTCCTCGTCGCCGTTG
TCGCGCCGGCGCGAGCCCAGGTCGCGCATGATGCGCGAGAGCAGCCCGTCCTTCCACTCGCGGGTCTTGAGCACGATGTACCCGTAGAGCTCGTTCGTGC
TCACGGACTTTGGGTTGAGGTCCTGCACCTCCATGGGCGTGCCCATGATCTCGCGAGCCTTGCGCAGCGTTTTCCACGTCTCGGTCTTGCCGCAGGACGG
CGGCCCCATGACGAAGACGCAGTGGCGGATCGCAAGCAGCTCCGAGAGCTGCACGACCTTGAGCATAAAGTCGGGTCGAGGCGAGTTCCCGATCGCCTCG
CTGGCGCCCTGGACCATGGACTCGAGCTCCATGTCGCGCTTCCGCGGTGGATCGTTGCGGACGTCGACATTCGGACTGTCGCGCGGGAACAAGTCGCCCA
GGAGCCCGAAGAAGATGACCGTGTCCTCGGCAACGATCTTAGGGATGTTGAAGTCGCGCAGCGCGCGCATGAGCAAGTCGATCTCGGGGATGTCTGGCTC
GGCTCGCTTGAACGCGCCCGCGACGCAGAGCACGCTCTTGACTGCGCGCAGCCCCCAGTCGTAGTGGAGCTGTTTGGAGAGCAGCTGACCCAGCAGCGAA
TAGAGCCCATAGAACTTAGACGCGAGGATCTTGGCTTGCGTGAAGCCCTCGGCCATGAGCATGTTCTCGCAGATGAGCACGAGGTCGGGCTCCATGACCG
TCATGGGCCGGAAGAGCGCTTTGAGACCCTCGGGCAGCTCCGAGCGGCCCAGATAGCCCGGGTTCATCGTGATGAAGGCTCCCACGGTCGGGTCCAGCAT
CACCTCGTCGTTCTCAAGGATGAACTTCTCGTCGTCGGCCTTGCACGCGTCGCAGACCGCCTTGAACTGCACCGAGCACACGGAGAGCACCTCGGGCACG
AGTCGGTTGAACTCGTCGAAGCAACCCCAGGAGCCCGAGGACGCGAGGCCCTTGAAGATGTTGCCGAGGCTCTTGAAGTCCATCTCGGGCGAGCAATTGA
ACACGTAGCAGACCTTGCCGAGCGCGTTCGCGAGGTCCTTGGTGGTCTCGGTCTTGCCCGTGCCGGCGGGGCCTGCGGGGGCGCAGCCCATTTGGAGGTT
GAGTGCCTGGGTCGCAGTCACGTAAATGCGATCTGTGAGCGGCGTGATCACGAGCCGAGGTCCGTTGCCCAGGTACTCGTAGTCGTACGGGATCCCAGCG
TCGCAGATTAGGATCTGGGCGCGCGAGTTGTTGAGGCCACGGAAGTTCGCGTCGCGCTTGAGGAAACTACCTTGCGTGGGAGAGAAGTAGTGCTTGAGCT
GCGACTGCCACTGGAAGGACGTGGCGTCGTCCACGCCGGCGCGGATCATGCTCGCGACAATGTCGCGGCCGTGGGCGTCCATGGTGATGAGCACCATCAC
CCGCTGGCGCTCGGCCGACGAGATGTTGCTCTGCGTGAGCCGGATGAGGTCCTCGAGCTGCTTCTCCTGCTTCTTGTTATAGTTGATGAGCGACTCCTTC
TCGCCTGCCTGGAGCTCGCGGAAGCACTTCTCGACCTCCTGGACGTAGTGGACCCCGGCGGCCAGTAGAATGATCTGGGCCGCGTCCATCGGCTTGCCGC
TCGCGTCCTTGAAGTTGATCCAGTCCACGCGCTCCTGCTCCGTGTAGGTCACAAGCGAGCGTTCAATGTGCTTAAAGAGCGTGAAGCGCATCGCGCGCAT
GACGGTCTCCAGGTAGATCTCGGCCTCACCCTCGAGCACTGGCGGCTCATAAAAGTCAACGATCTCATGGCCCACTCCAGACACGAACGCGGTCGCCGTG
GGCCGGCCGCCGCCCGGTGGGTCGCTCAGATCCAACGTCTTGGTCGCCAAGTAGATCTTGGAGCAGTGCGGCATGATCCGGTCCGGGTGGGACCCGTTCG
AGAGGATGTCGAGCAGGTCGGCCTCGGACATGAAGTAAAAGCGCGGGAACTGGCGCCGCCGACCGTCCAGAAACTCCTTGAGCCGGTGCTTGCAGAGCTC
GAGCTTCTCGACGATGCCCTCGAGCCGCTTGATGAGCCCCACCTCTGTACAGGCCTCGCGGACATTAAAGGTCGCCCAGGCCTTTTTCAGGATCTTGCGC
ACCTCGACATCAATATCTTCAAAGTCCGCCGTGAGCTCCGGAAGCTGCTTCTTCACCTCCTCGGACTGGATGAAGAGCGGCTCCAGGTAGCTCCACGAGC
GCTGGATGTCGCCCAGCAGTACGACCACTTCGTTGATCGACGAGAGCCCGAGCTGAAGACTCGCGACCCGCGGCTCAAACTCGGACTGGTACGGGGACGC
ACTCATGCCCTGGACGTCGATCTGGTGGGTCTCGAGCAGCTCAAAGTTCTCCTCTGACACTTTCAAGAGTGGCACAATGTCTTCCTCCGAGGCTCCTGGG
TTGTATGCATTCATCTCCCAGTTCACTTCGGCCCAGAGACCCTCGAGCTCGATCAGCCGAAGCTCGAGCTCCTGCTCCTTCTCGGCTTCGTAGCAGATCT
CGGTGATGTCGGAGCTGAAGTTGTGCAGATTCTTGCTCATGATGAGCGAGAGTTTCTGCTCCAGGTCCTCGTCGGGCGTCGGGAACTGGCCCGTGTGCTT
CATGATCCGCTGCCAGTGGCGCGGTCGCATGTACGTCGCCGAGACACACCGGATGAGCGGGTGAGTCTTGTCGAACGACTGGCACTCGTTTAGGATGGAT
GTGTACGCGTCGCACCACTGGATCTCCTTGGGAGTCTTCTTGAGCTCCTTGAGCATGGACTGAATCTCGATCTGCAGCGCGTTCACATCCACTGTGCGGA
AGAGCAGCTGCTCGATCGTGACGAAGAACGCCTTGGCACGCTTGATGATCGCCCACACGGTCTTCATGCCCTCGGCGTCGGCGCGCATGAGCCCCATGAC
CCGCAGCGACTCGTTCATGAGCTGCGGGAAGCCAAAGATCGAGCAGAGCTTGGTGTTCTCGTCGCACTTCTTCATCTCCATGTCCCAGTCGACCAGGTAG
CCCTCGATCTTCTCGAGCCCCTTCTCGGGCTCGAGCGCCGAGGACCAGAACTCGAGCGTCTTCATGGTCTCCATCTTCTTCTGGATTGTCTTCTCGTATG
CGACGATCTTCTCCTCGGTCTTCTCGCTGAACACGCGTGTGGGCTCCTGCACGCGATGCTCAGTCGTCGGGATCTGCTTCTGGACGTCGATGAAGAGCTT
CTCCATGTTCTCGATCTCCACGAGCTCCTTGTCGACGTGGCCGCCAGTCTTCTTGATGTTCCCAAAGAGCTGCCGGACCTGGTCCAGGATCAGGTGGTTC
GTCTCCTTCTCTGCCTCGAGCTTGCGGATGATCTCTTTGACCTTCCGGAGCGTCTCGAGGCCGTCGGTCTCGTTGCTCGGGATGTCCTTGCGCAGGTCGA
TGAGGATGCGCCGGAACTCGCCGTTGCGCTTGTTCATGTTGGCCATGAGCCGCCGGATGAGCTCGGACGAGTCCATGTCCTTCTCGCTGCTCAGTGGGGG
CATGCACTTGGCCTTGTTCTCCTCCGTCGGCTGCTGGAATAGGATCGTGAATGGCGAACCACGTACGGGGCCCGCGATCCCATTGAACGTGCCGTTAAAG
TCCACGGAGAGCTGGTACTTGCCCGCCCTTGGCGCGGCAAAGGTTACGACGTACGTGCCGTCGTTCTTGTCGACGACGCTCGTGATCGGCGGCTCGCTCT
CGTCCTCTGGCGTCTTGCTGCTGGCAGCATCGTCGTTTCTGAGCACGATCGTGAACTCGTCGCCGCCACAGTCTCGCGGATTGTCGTCCTTGTCTCGCGC
CTGGATGATAAACGCCGTGGGGAATTCGGCAAGCGTCGTGTCGTTGAGCGACGAGATGAGGCACGGCCCAAAGGCCAGCGACTTGGGCGCCGCGGTCACC
GAGTGGAACTTGAACGACGTCGATGCGTTCGTGTACATTCCACCGGAGAGCGACGCGCGCACCTCGGTGAGCAGCGAGCCGTACTTCTCAAAGCTTGGCG
CCGTTGCCTGGATCACCGTCGGGCTCAGCACCGTGCCCATGACGTCGACGTAACCCTTGGCGACCGCG