Description :
From Genome Similarity Track
Location :
Scaffold_301:1- 6565
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.11GTPase
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.12Glycoside hydrolase
Pytap_DAOMBR444maker-pag1_scaffold_301-fgenesh-gene-0.4Tyrosine aminotransferase
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.15Transcription factor jumonji (jmjC) domain-containing protein
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.16Conserved gene of unknown function

Sequence
6564 bases(100 bases per row)
TCAGCAGCACCCTTGACGAGACCAGCAATATCCGTGATGGTCATCACTGGAGGCACACTACACATAGATTTGTGTCAGTGTCAACTCGCCTCCtCcTTTG
CAGCCAAGTTGCCAATACGCACGTGTTTTGTGGCTTGACCTTCTCGACCAGCCAGTTGAAACGCTGGTCCGGCACCGGCACGACAGCCTCGTTGGGCTCA
ATtGTACAGAACGGGAAGTTCTCCGCAGGGATGTTCATCTTCGACAGACAGTTGAagAACGTACTCTTGCCAACGTTCGGCAGACCGACGATACCGATCT
TGACATTGTTACCTGGACGACCAAGGTACACCTTTGGTGGCGCTTCCTGCGCTCAGCCATAAATCGGGATGAGCATCTCAGCCATGGTGATGCTCGTGAC
CTCGTCCATGCGCACCTCCTTCTTCTTCGGCGGCATGATGCTGAGGCTGTCGGACCTGAAATGGCTTGATGTACGTCACACTGTTGCGTTGTCTCAAGCG
GTTGGCCTCCAGcGAGAGGTGAACTTAGGACACAGGGCGGAAGGAGAGGGTTAACCATTCTGTCACAAAGATACGCGCCGTGCGGCGGAACAGTTCTCAG
GTGGGAATTCCAGTTgaaaaaTTCCAAgTTGGAATTTTCCAACTTGATGAATGTAGTAATAGTGTGcGcAACAAGAAAGCATTCTTACGAGGGGTGTAGA
GATCCTCCAGTGAGGAATGAACATATCTACAGGGCAGAGGTTTGGCCAGCTCCTTCGGCAGGAGCTCGCAACTTGACTTGATCCGCAAGACGGTCAGTGG
CTGCACATTGGACACATGCATAAGTTAGTCAGGCGAACGAACATAGTgAaGAACGTAAACTGCGTACCTTTCTTCTTCTTTGCTGCGAGCACGCCCAGTG
TAATGAAGACGACAACCATGACACCGAGGAACACACCGATACCAGCAAAAATGATCTTCGGAGCGTCCTTGCTACTTGTAAGCTTGCTGCACGAGACAAT
ATCCTTCACGCTGCAGTCACTGCCGCTCCAGCAaGCGAGGCAGCTACATTGGTTTTCTCCGTCGACTGTCAGACACTGACCATTCTGACCACAGTCAGTT
GAAGTTTTGCATTTGCCGCCACCTGATTCCaCcTTGTAGGTTCCACCGCAGAGAGTTTCTTGCGTGGTGCTAAGAGCATCGCTCACAGTGACATCACAAC
GGCCACCATTgTTCGAACAAGCAGCACCCTCACGAGTTTtCGcAACCCATGTGTCCGTCGAAGCAATCTTCAGCACGCTAGATGTGCAGCTATCAATGAT
CCAGCCGCTCTTCTTGGCACGAGTGTTCGTTGAACTGATCGACTCCTTGACAGTGGgCGCCCACGTGCACTTCGTGCTGTCAGTCCATTCGGCAGATtCC
TTGTACGGCGAGTACTTCGCAAACTGACTCTTGAGGTAGGTGTAGTCAGGCGTTACCTGGTAACTAGGAGTCTCCAAAGGATCCAGCGAACCACCTGTGG
TTGAGTATAGGTCAGTCGATAGCTAATCGCGTGGCACTACAGTCATTTGACCTACCAGTAAACATTGGGAAGCCAGAGTTCAGGTCGAGCTTCGCTTCAC
CGTACGAGTAGGCAAGACCTCCGGAGAAGACGTTGGTGAAACCCTTTGTTTTAGACGGCTCTTGGTACAAGTATGGGACCATAGGCCACTCTCGTGTCAC
CGTTTTCGGGGTATGACAACCGTACTCGCCAAAGCCAACCACGATTGGGATGCCGCTGACGATTTCGAGGAACTTCGCGTAGGTAGCGTCGTAGTCCACG
TCCATGCACCAGCGGTACTCATTGATGAGATACATATCAATGCTCTTCAACATCATGCCATCCTTCATCGTGTCACCACACAGAAGACCTTGAATCTTGA
CGACATGGTACTCCTCAGGTTGCAGCTTGGTTCCATACGAACTATCGGCAGCAGCGTACGCAAGCGGGAGGATACGCATCTTCTTGCCATTGGAACGCAT
CCAGTTTTTCAAGTCAGCGGCATACTGCTTAACGCAGGCACCAGCCGTCAAGTCGACCTGCATGATTTCGTTGGCAAGAATAATACCAAGTGTGTTGTCG
TACTGGGCGAAGTTACGGGCAATCTACAACACCGATAGCGGTTCGTCATGAACACCTCCACGCGCATTTGAAAGACACTACCAACCTACCTTTTTGCCGT
ACTCCAATAGCAGCGCTGGGTAGCACGTATCACCACTGCTTGACTCTGGTGGGAGATCTTTTCGGATCGGAGCGTATCGGTACTTGCCGAAGTATTCCGA
GTTATCTGGCGAACCCGCCACAAGAACATACACACCGAGCGCCTCCATGTCCTGCATGAACAGCTTGTAGGACTCATCCGGGTTGATGTTGTATACACGC
AGCGTGTTGAACTTGAGGTCCTTCAGATTCTTCGCAATAGCCGCCTTCGAGTACTTCGTGTAGTACGTGTCACTCACAGCGTATTCGTACGTCAGCTAGA
CAGACATCACGATATCATGAGCACGCAGCAATCTCCACTTGACGCATTCCAATCGAAACTCACGCCTTTCATCATGAACCGCTCGCCCGTCTTCTGGTTG
TAAAGCTTGTTGCCGCGCACGACGATCACGCCATTCGACGCCTCCACAGTCGGCGTGACCCACGAGACGCCGATCAGCGCCGCCAGGGCCGTGAGCGACT
TCAGGACGCGCGCCATTGTCCAGTGTGCCAGGGGGAAGCGCTTCAACTCAGTCGATGGTGTCGAAGTGGCCCGAGTGCCAGGAACACAGAGAGAAAGCGA
CGGCGAGCTGAGCCAATTGAGgtACCCAGCGGAGAATTTTtCAGACGCTGTGGGTCGACcgACAGGGGGGTTACACCAGGGGGTTACGGGCGCTCGCCAT
TGGACGAAAACCACCTCCATTAAAAATCAGGTGTGGAGAAAGGGCTAGGGGTCAAGTGGgTTTTCGCCCGTGTCGAAACCACACAAGGGAATTGCATTAC
TACGTAGTACCAAGGAAATTGTATGGAGATGTCACATAAAAAaaCGGaGGACAACAACATGCCACCCcAAGCAGCAGAGATaaTCGGTTCCACCAGGCGA
CTGGCGATGAGATGCTGTGCAGGAATCGGAACGCTGcGGCTTAGTGGCTGTGACGCTTGCAGAAGTTGGCAATACGAGTGTATGCATCTGCGAGGACTTC
GTGGGGTGCCGAGAACACGATGCGGAAGTAGTTGGTCATGCCGAAGCACTGACCTGGAAGCACAAAGACGGACTCTTCGTCAAGGAGCTTCTGAGTGAAG
TCGAAGTCGTCCTTGATGCCAGTGAGGATGCTGGTGTCCACTTGTACCTGTATTCAAAGCATGTGTTAGATAAAATGAAGCGGTAATGGTGTATATAGAG
GCCAACATCAACTCACCATGACGTACATTGCGCCTTGCGGCACGACTACCTTGAGACCGCGAACCTTGCTTAGGGAATCAGTCGTGAACTTCGAGTTCTT
CTCAAGAGTTTCATAATAATGGGTCTTGAACTTCTCGAGAGATTCCTCCTCCGCACTTCCTGGCATTGGAGTGAGAAGGTCTGGAATCGCACTCTGCACA
ATACACGATTAGTCAATCGCGTACAAGGTGGAGTGAAGGATATCaTGCACCAACCAGAACGAGTGAGTTCGCACCGAGAATcAATTGGGACAACTTGAAG
TAAGCAGTTCGCACTTCCTTCAGAATATCATTGCGGTCATGCACCATAAGCCAGCCAACGCGCCAGCCAGGAATAAGGAACTTCTTCGCAAGACCACCAA
CGGAGACAACAGGGACCGTCTTCGTCAACGTGGCCATCGGGAAGAACATGTTGTCACCGAACACCATGTCACCGTAAATCTCGTCCTGTTTGTGCGTGCA
CATTTGTAAGAAACAGGTTAGGAATTCgaCGGAGACTaCACATATCGTACCGCAATCACTGGAAGCTTGTGGTGATCGGCGACAGCGAGGACTTCCTCGA
GATGCTCCTTCGAGTAGACACTACCACATGGGTTGGATGGGTTGTTGACGAGGATAGCCTTCGTGTTCTCGTCAATCAGGGACTCtAGTTGTGCGACATC
AACTTGCCAATTCTTCTCAGGGAGGAGATCGTAGAACTTGCACTTGATCTTGTGAGCATCACAAATCACCTGGTACAGAGGAAAGCCTGGCTTCGGCAAC
AGGATGTTGTCTCCAGGGTTCAACAGACCAGTGATAGCAATATCGATCGCGCCTGAGCAACCACTCGCAATCACGATGTCCTACAATCAAATGATGTTGC
CATCAGTATCAATCCTGCTGGCGAGCATCGCCATCTGAACACcGTACCTCCTTGGTGAGTGGCGCCGCGTCGCTGCCAAAGTGCTGGGCAATAGCCTCTC
GCGCAGCTTCTGTTCCTGCCGAGTGAATGTAGCCATTGTGCTTCATAGAGCTAGAGCACAGGCACCATATCAGCATCCCTTCTCCTTTATATAGCTCAAC
ACCcTCGTCATACCGAACATTGCGCACGATGGACTCGACAAGCACATCAGGGCACTTGAAGTTGCCAAAGACGGTTGGGTCACCTAAGGCATCATGAACA
CGTCAGCTCGTGCGCACCAATCTAGTTGCGCGGATTTCCTACCAAGCGAGAGCGGGATGAGTGCCTTATCCGAGTTCTCCGGCTTCTTAaTGTTGTCAAC
GATTTTGCGGATAGGGTTGGCCGTGAGCATGGAGAACTCGGACGGCACGAcATTCCAGACGCGCTGCTGCTTGAGTTTGTGCGCATCGgAGGTCATGCCA
GCgTCAGAACTCGTGCGCGTCGTCATGTTCCTCTGTGGTCGTTCGCGGTGCTGCTTGCGTGTTGGTGTCTGTTTtGTGgaCTGATCCGGCCTCTAACCCC
ATTCATTGGCGAACCTCGGACGTCTGACGGCAGCAGTGGACGaaaaaatGTCACACACGCACCGACGCACGCTGCATCATCACTGCTCGAAGTTCAACAT
CTCCTTCTCGTCGACACAAATCCAATACCTTGTCTATACTAATACCAGGCATTAAGagCTTGTGTGTAGATTTGCGCCTCTAATAATCGATATGGGGtGT
TCTTTTCGTTTGcaGccAagtggaTGGTGCAGGAATAGACACATTCGTGCGACATTCAGACAACATCCGAGACGAGAATGTTCTGAGCATGCTTGAAGTT
CGTCGGCAAACCCGTCACAAGTCACACACTTCGTACACCACCAACCAGCAATCACGATTTGTAGCATCTCAATtCCGTGCGCAGTACTGTTTCATCTGTC
GAGGTCGTTCTGGTAGTTGGCTGATAGCCGAACGTCGAGGCAAGTACCCGCTCGAAAGCCTTTCGCATGAAGTTCTCCTGTTTCGtAAGGAGgCTTTCCT
TGAGCGTGcTCTCTTCATCTCCAACAGCGGTGAAAAGTTCCAAGACCCAACCTTCATTATACATGGTTCGGTCCCAGAATTCGGTCAAGAACGCTGCAAG
TTCGTCcGAACTTTCGCGCAAAATACTCTTCCACACATCTGGATAATCGTTGGCTAGCTGCATCTGTACGGTCCGTTGATCTTCATCGGGCACTGTAAAC
AAGAAGTTCTCAAGCTTCTGCTGAGATAAATTTTCTGTGACGATTGCCTTGATAGAAAACGCTTCGGCATTGCCACcAAAAGTGATTCGCTGCGTGCACC
TTAGTTCCCGAAGCATCGCTTTGGTCTCTGATTTCACCAACTCTCCGATCACGACTCTTGAATAGTATGTTACCATGTCCAAATCATCAACGAGTTGAGT
TCGAAGCCCATCAAACCAAAAGTTGATTGCTACAGTGAAAGCATCGGTGTCGACTTGATGCCACCAGCCTTCTGGGATATAGATTGCATCTAAGAGAGCA
CCACCACAATCGAGTCAACCACTCGTCCCGCGTTTGCATTCGAATTTCTAACTTACCACCTGCCGtAGCGGTCAAAGTGACCGCTTGTACATCCTTGAaT
CGAGGATGGGCCGTTAAATCTGGATTCACGAAGTTGACGCTACTGTGGTTTGACGATTTGGAGTAGACTGGCCGCGCATAGAGATTTGAAGCTTCTGATG
GAGGGTACAGTTTCACAGTTTTCCGGCCaTGTAAGACTACGAGAATATTGCGATAAGCATCATAATGGATCGCAGTCCTACTGGACAGTGCGGTCATCCA
CAGGTTTACTTGGCTTAGTCGTTCAGATGATATTGCCGTAGGACTTCAGCATATTACAGGCCGATAGGTCAGAGATATCCGTGGGATAAATGCACAGTGT
CCGTACATATCAAATAGCTTCATGATCTTGGGTAACACAGGaTCTTCACAagTCTCaTCGGaTTGAATACGGCTAGCGGAATCTGGCAGAGATAAAACTG
AAGGCCAGCCACCGAGCTTAACCAATGCTCTTCACCACGAGACAGAGCGACAAAATAGTCCAAGAAGTCTCCAAACTTCAGCTGGACACTCTGTCGCTCC
GTGTGGTCACCTGAGTATATGTCAGACTCTGTCTCTTTGCATGCAACATCAACGACTGTTTCAA