Description :
From Genome Similarity Track
Location :
Scaffold_164:1- 5980
Transcript NameFunction/comments
Physo_144046hypothetical protein
Physo_144047hypothetical protein

Sequence
5979 bases(100 bases per row)
GACAGCAGGGTCTCGGACACGATGGAGGTGACCGTGGCCTTGGTGGACGTGGTCAGCGGCGTCTCCGCCGACATGGACACGGACACGGACGCGATGGTGG
CGGGCGACTCGGGCAGCAAGCACAACGGCGGCCGCAGCGCCGTGTGTGCCGTCAACAGCATGGTCTCGGAGGCTTCCGCGGCGACCGTGGCCGTGTTGGA
CGTGAGTGGCCGTGTTGGACGTGATCGGGGGCGTCTCCGCTGGCATAATCACGAACGCGACGGTGGCATTCGGCTCGGGCAGCGAACGCAACGACAGCGG
CAGTCCGCACGCAGGTTGCCGTAGGTAGTAGCGGCAGTGGCGTCGCCAGCGACATCGACAGCAGGGTCTCGGACACGATGGAGGTGACCGTGGCCTTGGT
GGACGTGGTCAGCGGCGTCTCCGCCGACATGGACACGGACACGGACGCGATGGTGGCGGGCGACTCGGGCAGCAAGCACAACGGCGGCCGCAGCGCCGTG
TGTGCCGTCAACAGCATGGTCTCGGAGGCTTCCGCGGCGACCGTGGCCGTGTTGGACGTGAGTGGCCGTGTTGGACGTGATCGGGGGCATCTCCGCTGGC
ATGGTCACGAACGCGACGGTGGCATTCGGCTCGAGCAGCGAACGCAACGACAGCGGCAGTCCGCACGCAGGTTGCCGTAGGTAGTAGCGGCAGTGGCGTC
GCCAGCCACATCGACAGCAGGGTCTCGGACACGATGGAGGTGACCGTGGCCTTGGTGGACGTGGTCAGCGGCGACTCCGCCGACATGGACACGGACACGG
ACGCGATGGTGGCGGGCGACTCGGGCAGCAAGCACAACGGCGGCCGCAGCGCCGTGTGTGCCGTCAACAGCATGGTCTCGGAGGCTTCCGCGGCGACCGT
GGCCGTGTTGGACGTGAGTGGCCGTGTTGGACGTGAGGCTACATGAAGCAAGGTGTATGCTTAGAGAAGCATATTGTCGCAGCTAGTTGGGTGGATGGCT
CAATTGTCAATGTCGTGTCTAATGCCGATGCTTCGACCACATCAACTGTGCATCGTCGTATAAAAGAATCGAGTGTGGCTTTCACTGCTCCTACTTGCGT
CGGGGAGTATAACTCAGCGATGCAAGGTGTTGATCGGCTCGACCAACTGCGTGCACGATTTTCTCTAGCCGATGACCACTCATTTCAGAAGTGGCATAAA
AAACTAGCGATGGTCATGCTTGATATAGCCAGATGCAATGCCTACATTTGCGATAGTTTGGCGCGTGGTGAGAGCGAGGAGTCTCGTTCGACGGGAGGTA
CAGCCCAAACGAGGTCAAGAGCCCGCGATAGTCATCGCGCATTTGTGGCATCACTGGTTCGAGAACTGTTCAACGGGGACTGGAAGAAATCTCTGGATAG
GGAACATGGAATGGTGTATGCTGCGAAGCCGACAACGACAACAATGCCGACGACGACCCAAACCGCGGCGTCGGCAGATGTATCCGAGTCTTCGGGCGAT
CACGTTCAAACGTGTGTTGCAAGAGCGTCCTCGGAGGTGCTTCAGGGAAGGAGTCGCTCAATGCGGAAATGCACTGTGTGGAAGTTCGAGGGCAGAGATC
CTACCGAGAAAACCGACTACTGCGAGACCCATCGAGTTGCGTTGTGCAAGCGCACATACCCTGTTGACCCAACGAAGCAGCATCTGTGCCAACAGCAAAC
TTGGACTTGCTGGCAGAAATACCATTTGTTTTACTTGCCGAAGCAAGTGTACACTGTCGATGGCAACTTGCGACGAACCTCTCCAATTTATGTAGCTAAC
CGTCCATTTCTGAAGGCCCGCCAAGAATAAAAGAAGGCTAACGCAGCCACCAAGGCGTAACCTCACATCATTTTTTCAAGATAGTCAAAGTCAACTAACC
ATTTATACTTCACTGCACTAAGTCACACCTATTCCATCTGCCCCCGCTAGTCTTGATGCCGTAAATGCGAATTTAGCTCGTGGCTGACAACATACTGTTT
TACCACTGGTGCACCATAGCGGCAAGCTAACCACACTCCACTGCGTATAATCCGACAGGATACTGTTAGAAATTCCACCCGCCTCCAACCATAACAATAA
CTCCCAACTATGTATATGTCAGCGAAGACGCCTCAGACCACATCCAGCACGGCCACGTTCGCCACCACCACGTCTGAGGTCATGCTGCTGACGGCGCTGC
CACGGCCGCTGCCCGCGCTGCCCGAGTCGCCCGCTACCATTGCGTCCGACTACATGCTGACGGAGTTGCCACCGATCACCTCCAGTACGGACACGATCTC
TACAAAGGACGTCATGCTGTTGATGCCGCTGACGGTACTTCTGGCACCTCTACAACGGTCTCCTTCCGCACTGTCGATGCATTTGCGCACGCTGTCTGGT
CACCGGTCACATTCTTGCCAACCTCCGTGCCGGTGGAGGCACACACGACCACCCCCAGCACGACAACGGTCACGCCCAAAGCTTCCGTGGTCATGATGTT
GCCGGCGCACACACGGCGCTGCGGCCGCCGTTATGCTTGCTGCCTGAGTCCCCCGCCACCATCGCGTCCGTGGCCGTGTCCATGTCGGCGGAGACGCCCC
TGACCGCGTCCTCCAAGGCCACGGCCACCTCCATCGCGTCCGAGACCCTGCTGGCGATGTCGCTGGTGGCGCTGCTGCCGCTACTACCGGCGGCGACCTG
TGTGCGGCTGCCGCTGGCGTTGTGCTCGATGATCGCGTCCGTGCCCCTGGGGACACAATAGTGTTGATAGAGATACTACAGAAGACACAATAGCGTGGGG
TTTTACCTATCCCTCTTACCTGTATGATTGGTCATAAACGGCGAGGATACTGCCGTGGCTTAGAAAATTGCTGTTTCAGTTATCTAAGTAAAAAGATACT
TGATGTATCATTCTGGTAACGATAGGGTTAATAAGGGGTCTCTTGAAATTGGAATAGGAACACCTATGATAAAAACTGATTATATTTCTAGATAAGGTAG
AAGAGATTGCTTACACGTATTATGATGGATGTCCCCGACTTGGACTGGATACCGTAGATGACAGAAGCGAAATATGCTGTAATTAGCGGATGTTAGCAAC
TTCGTAAATCACGACTCAAATTTACGGTCAACATTTTTATGTGTTTAGTTAAAACGAAATCGTCCACAGTGTTAGCATTCGCGTATCTGCCCATTTACGA
AATCCAATGACTCCCAGCGATAGAGGTCGCCCTGCTGACACGAGATCCTGGCATGCGCAGCACTATTATACATTGCGCGTCCGGGCGGGTGCACCCGGGG
GAGATCACAGTTCGTTAGGCACTGCTTTGTTGCACTTTGCTTTGCTTTGTTGTGCTTTGCTTCGTTGTATTGTGTTTTGTTTTGTTCAGTTGGGTTGTAT
TGTGCATTGTCATATTGTATTTTGTCGTTCAGGGCGAGACTTTGCTTTATGTTTGAATAACTGCGTATATTTACTTAGAGACCATTCATCACAGTAAACA
TATAGTCGGTCATATCTTGGCAGCCGATATACCAACCTCATTATAGTCTTGGAGTTTGGTAAGTCACCCAGCGAGAAGACGTCACTGGAGATGAGCCTGG
AGAAGGGCGACCACTCACAGGGTAAGTGGACGGGATACTGTTCAGAGATGATGGAGGTGTTCCCATGGGAGATGGTGAATATGACCCATCGCCGACGCGT
GTGCTTGATTTGAAGCAGGTCGAGAAAGAGGTACGCCGCCGATACCATGGTTATCTGACTAGGCAGAGAATGGAACTGACTTGATGGGGGGGGGTCGATG
ACGCTTCGTAGTCACCGTCACCAACCTTCACGGCATCACTTTGGTCTTCTTCGCCTTCTTCACACCCGGCGCGGTCTTAATGTCCGTCCGGAAAAGCTGA
CCACCGGGACGGGCAGGGTCACGGTCTGTCTTCACCGTTGGGCAGGACTTCTTGAAGTGGCCTGCCTCAAAGCAGTAGAAACACTCAACACAATCCGTGC
CCTTTCGCTTCACGCTGACCTACTTGACGGAGCAGATTCTCGTTGCCTTCTTCTTTTCGATGTACGGGACCACCTCTTGACGCGGCTTGTCGCCGATCAC
ACGTCGCAGCCTCATCTCCACATTGGCGACAGTGAATATCGCGTTCGTCATCGAGACAGAACTCGCCCAAAGTTCACTCGGTAGCTGCGACAGGACCTCG
ATGTATAGCCATGCCTCGTTCACCATCCCCTGACCTACCAGTACCTTAGTCTTCCAGTTGATCTCGTTCCTCAGCTTCTTCAGCCGAGCAAACAGAGACC
CAACATCCTTCGAGTTGGATGCCAACACACGGCCCCACTGCTTCATCAGTTCGTTGATGTCGCCGCATCTCCCAGACCATAAGCCTGCTCTAGAAGCCCC
CACACCTCACATGGGTCCATCATCGAGACAGTGTCCGGGAGGGTGGACAGGAACCCATTCGGCAGCGACTGGTTGAACAGGTTCTGTATGGCCGTGCGGG
CCCGGTTCCAGTGCGCTAGCTCCCAGCGCCCATCATGCACTACCTCCGCTGTCGCATCATCCCCAGAGAGGACGACTGGCTTCTCAGGTCGACCATCGAG
GAACGTAGCCATGAGGACCCTGGCGTCCGGTAGCTCCTACTCCAGCAACTTTCTAAGGTACGCTTGACCGAGGTCGTCGATGTGCGTGCGCACCTTATCT
TCCCACATAGTGAACTCTTGCTTGTTGCCGGAGAAGCGCTCCAGGCCCAGCGAAGAGTTGGGCTTCAGACTTTGAGTCATCTTGGGCGAGGGAGAGAGTC
TTGGTCGTAATTGAAATGTTGCACTTGTTGTTTGGCTGTCCGTTTTGAACTGAGAGAGGCGCGGGCATTGGGCTGTCCCGATACCTATCTCTCCTCCAGT
CATTGCATCCCTCGGCAGATAGTTTTTCGGATGTGCAGCTCCTTTCGGCTGATTGGATAATATGAGGCGAGGCGGGTGAACGCCTTTATCATCCAGGATG
TATAGCGTTCGTCCGGTAGGCTTAGACCCGGGAGGGTTTAGCTTACGGAAATCCAAAACGTACAATGAATATAAGCTCCGGCTGGCGTGTGATCTAGTGG
AATCTGTGAAAAGGCTCGGTGGATTTCGCCACCAAACCCATGCCCAGCTGACCCATATCAATCAGGCAGACTTTAAGTGCGTCATGGCCGCGATGGATCT
GGACCGCCAACTGTCGGGCACGAGCCGTGTGACGAAGGAAGCTGAGACCGAGGTCTGGGCGGAGCGCCGCTCAGATCCTGGGCTTGAGCGAAGTTTGTCT
GGGACCCGAGATGTCTGGCGTTGGGTATCCCAAGTCCGAGCTGAGTCCGGAAGCTGAGAGAAGCTACGCGGAGTCTGAGCTGAGCCTCGAGTGTGATGGC
CGGAGTCCCCGCTCAAGTCGAGAAGCTGAGCGGAGCCGGGTGGAGTTTGAGCCCAACCCCCCCAGTGGTTATGGAGCCGTCGTCCACGATGCCGAGCTGA
GTCAAGGAGCAGGTGTCCGGGCGAGGTGGTGCCGAGCCCGAGTCTAGCTTCTACTGTGGTCATGGAGTCTTCACCCAAGTCGACAAGCTGGCCGAGGACG
AAGGTCTGAGCGGAGGGACGTGGGGTCCGAGCCCAGCCTCGAATGTGATGTTTGAAGTCTTTGCCCAAGTCGAGAAGCCGAGTGGAGTGGCATGGGCCTG
AGCGGAGTTGTTGGAGTCCAGTTGAAGTGCCTTGTGACGAGTCGCTGAACTTAAATCCAGACCGTGGTACTGACGGCGAAGTTGGTGGTACCGGCGAGTA
CACTCATACGGTGTATCATCCAGGAGCCTGCCTACATTGGGTGCGACCGCTCAAGATCGCGGACACTTCAAGCAGATCTCAACAGCCTGCAGCAGCTACA
CGATGACGCGCACCGGCGTGGAGCCGCCGCATTGGCCAAGACCAAAGATTTTGGACGGATCTGCAAGGACGCCCGGTAA