Description :
From Genome Similarity Track
Location :
Scaffold_529:1- 5775
Transcript NameFunction/comments
g17677.t1hypothetical protein
g17678.t1hypothetical protein

Sequence
5774 bases(100 bases per row)
TTCGCGGCACGTGTGGAAACTGCGAGGCGCCACCCAGCTCGCACAGCGCCAGCACAGCAGCACAGCAGCACAGCAGCACAACAGCACAGCAGCGCGGCAG
TAGCTGACTGTCCTGTCGCCGTGCTGGCCAGCATAAAGCGCGTCCATCCGGTGCGTGGCGGCGGCAGGAGCGGAAAAGCAAAATTCCCAAACCGGGACTC
GAACCCGGGTCGCGTGGGTGAAAGCCACGTATCCTAACCGCCTAGACTATTTGGGAGCACCTTCTCTTAACCAAACACCACGCCCACACACAACCCCACC
ACGCGACTCACACACGCCCACACACACCTATCTACACTACACCGCACCTGCCACCGTATAGCACGCCCGATCACTGCTCACCCGCGGCCCGACGACGTCT
GGAAACCCGAGCTCGCCTCCACGCTCTTCGCGGCCACGTGTGGGAACTGCGAGGCGCCACCCAGCTCGCACAGCGCCAGCACAGCACAGCAGCACAGCAG
CACAGCAGCACAGCAGCGCGGCAGTAGCTGACTGTCCGGTCGCCGTGCTGGCCAGCATAAAGCGCGTCCATCCGGTGCGTGGCGGCGGCAGGAGCGGAAA
AGCAAAATTCCCAAACCGGGACTCGAACCCGGGTCGCGTGGGTGAAAGCCACGTATCCTAACCGCCTAGACTATTTGGGAGCACCTTCTCTTAACCAAAC
ACCACGCCCACACACAACCCCACCACGCGACTCACACACGCCCACACACACCTATCTACACTACACCGCACCTGCCACCGTATAGCACGCCCGATCACTG
CTCACCCGCGGCCCGACGACGTCTGGAAACCCGAGCTCGCCTCCACGCTCTTCGCGGCCACGTGTGGGAACTGCGAGGCGCCACCCAGCTCGCACAGCGC
CAGCACAGCACAGCAGCACAGCAGCACAGCAGCACAGCAGCGCGGCAGTAGCTGACTGTCCTGTCGCCGTGCTGGCCAGCATAAAGCGCGTCCATCCGGT
GCGTGGCGGCGGCAGGAGCGGAAAAGCAAAATTCCCAAACCGGGACTCGAACCCGGGTCGCGTGGGTGAAAGCCACGTATCCTATGTTAGAGGGTGCTGC
GTGTGCATGTGTGTGTGTGCACCAGGTGTGGGTGCAAGGCGTGTGTGCGTGCGCGTGCCTCTACGCGTGTGCGGGGGGATTTGTGGCGGCGTCAAGTGCT
CATGATGAGACGCGCAGGTTGCGTGCGCGTGAGAACAAGCGTGTGGGAGCGTGTCCAAGTGCTCAAGCGGCGTGGACATGCGTGTGGGTGCATAGTAGGA
GTTACATATGTAGGAGTAGGGTGTGCGTGACTTTGGTCATGCAGTATGGTGTAGTGGGTTAAGTGCCGGGTCTTTGATCCGAAGGGTGTGGGTTCGAGTC
CCCACATGGACGTTTTTCTTTTTGCCGACAAGAGAGCGTAGGAGGCAGGCTAGCAGCTAAAACTCACTCAATCAATCTCACTTTTGGTTTTGCAATCTCG
GCCCGAAGCCGTCTTCTAAGCTTTCAACTCTCCGCAGCTCGTAGCCCAACTTCCTTTTGGTTATGAGCCCAAGTACCGACACCAAGTTCAAGGTCGAGCC
TTTCGACGGCTCGAACTACTCGCTGTGGAGCTACAAGATGAAGATGTACCTGATGTCCAAGGGATTGTGGGAAGCTGTCTCCGGGGAAGCCGGATCGACG
GCGAAGGAGCAACAAGCGCACGCGGCGATTGTGCTCAACCTGAATGACTCGCAGTTGATGCACGTGGTGACGTCCACGACTGCGAAGGAGGCGTGGGACA
CGTTGAAGAAGTTCCACAAGACTCAAGACATGGCGAACCGGCTGTGGCTCAAGGAAAAGTTCTCGGCGTTCAAGTTCACGGCGTCCTCCGTCGGCAAGCA
CGTGACGGAGTTGGAGAAGCTCGTGATGGAGATGAAGAACGCGGGGTGTGAGCCAACTGAGGAAGACGTCTGCGCGACGATGCTGCGGAGTCTGCCATCG
AGCTACGAGGCTCTGGTTCAAGCGTTTCGCATGTCAGTGAGTGAGTTCAAGCTTGCAGACCTGGTGAGCAAGCTGATTGCGGAAGAAGTGCGTCAGAAGG
ACTCGAACCGCATCGAAGAGGCGACTGCGCTTCTTGCCGGCAAGGGCAATGGGAAGCAGCAGCAGAAGAAGAAGAACGCACGCGGGATGCGCAAGAAGGG
GCCCTTCGGGAAGTGTTTCAACTGTGGCAAGCCTGGCCACTATGCGAGGGATTGCCGTTCCGAGGCAAGTCCCGATGAAGATGTCCAAGACCAGTCGAAC
GTTGCGTTCCATGCGACGGAAGCTTTTGCTAGCGAGTGCTGGGTGATGGACAGCGGTGCTTCGGCACACATGTGCAAGACACGCGACGCGTTTCAAGAGT
ACTCGGGTGTAAAGACTGCGCGCACCATATCGAGCGCAAAGAGCAGCGCGAGCTTGAAGATTCTCGGGGTTGGAACAGTTGTTCTGCGTGTCTGGACTGG
TAGTGCGTGGATAAACGCGCGACTGGAAAACACACTGCACGTTCAAGATTTGAACAAGAACCTGTTCTCTCTCACGGCTGCAACGGCACGCGGCATGACC
GTGACTATGGACAGCGAGCAGTGCGTTGTGAAACGCGGCGGCCAAGTGGTGGCGACGGGCAGGAAGCAAGGCAAGCTGATGTTCCTCAACATTGAGGGCG
GCGACGAGTGCCATGCGGCTGAAGACAATATGGATTTGTGGCACCGGCGACTCGGCCACGCGTCTTTCGGCACGCTGAACTCCATGATCAAGGACGGGAA
ACTCAAGGGTGCGCTGGCAGAGCCTGGAACCGTGTGTGGCGTGTGTGCGACTGCGAAGCAGGCACGCAAGCCTTTCAAGTCGACCAAGGAGGGACTCGAA
GCCAGGGAGAGCGCACGCAAGGACACCACTGTGTGCTCTGATGTGTTGGGGCCCGTCACTCCTGCATCCAAGTCGGGCTACAAGTACATTGTGAGCTTCA
TCATGATGAAGAGTCGCTTTGTGACAATCTACCCACTGCGCAAGAAGAGCGAAGTGTGTGAGGCGTTCAAGAAGTTTCTCAAGGAGGCAGAAACAAGTGC
GGGCATCAAGGTCAAGGTGCTACGCAGTGACAACGGCGGTGAATACTGCAACGCGGGGATGGTGGCTCTGTGCGACGAGAAGACCATCAAGCAAGAGTTC
ACGGTGCCTTACAACCCGCAACAGAACGGCATGGCAGAGCGGATGAACCGTACGCTGGTCGAAATGACACGCTGCATGCTGGGGGAGAGCGGGATGGACA
AGTCGTACTGGTGCGAAGCCATCATGACAGCTGCAGACATTCGGAACGTGTTGCCTAACACGTCAAGCCCACACGCAAGCCCATTCCAGCTGGTTTTCAA
GAGGGCGCCACGTCTGGAGCACATGCGCGTTTTTGGGACCGAGTGCTACGCCCATGTGACCAAGCAGAAACGCAAAAAGCTGGACAACTCGGGGATCAAG
TGCGTGTTTCTCGGCTACGCCAAGCAACACAAAGCATATCGACTCCTGGACCCCAGCGACGGATCGATCGTGATTTCAAGGAGTGTGGCGTTTGCTGAAG
CGCCACCGGTCACAATGGCGAAGACGCGCAACCAGGAGGTGATCGACATCATCGACAACGATGAAGAAGAGGAGCGCACCGAAGAACCCAGTGTTGACGA
CGGTTTCAGCACGCCCCCGACACGCCCACTCCACGAACCCGAGGAGCACAGCGGACCGACCGGATCTGTGCCAACGCGTGGCTCTAGCACGCCAGGGAGA
GACGGCGAAGAGGAGTGGATGGTGCGTCCGGCACGCAAAAGGCGTGGAGTCGTGCGCTACCAAGACGAATTTCCCGGGACTCGAAGGGGTGAGTTCAACC
TGGACGACTACGAGGCTGAGTTCGATTCCCTCTACTGCTTCCTCACCGAAGACGACGACGGTGAGCGCGCGGTGTCGTACGATGAAGTCATGCGGAGCAA
GTACAAGGACGAATGGCTGCGCGCCATGGAAAGCGAAATGAAGTCGCTTGAGGATCACCGCACCTGGAAGTTGGTGGACATGCCGTCAGACAAGAAGGCG
ATCGGGTGCAAGTGGGTGTTCCGTATCAAGCGTGACCCGAGCGGGAAGATCATCAAGTTCAAGGCTCGTCTTGTGGCGAAGGGCTTCACGCAACGTCCAG
GGGTCGACTACACGGAGACTTTCGCTCCTGTAGCACGCAAAGAGTCCATCAACACGGCGGTGGCGATTGCAGCAGAGGAAGACATGGAGGCTGAAAATGT
GGATGTGGACACCGCGTTTCTCTACGGCGACGTTGAAGAGGAGCTCTATATGGACCAGCCGGACGGATTTGAAGACCAAGTCAACCCAACCAAGAAGTGC
CTGTTGATGCAAGCGCTTTACGGCACGAAGCAAGCGGCACGCCAATGGAACAGCAAGCTGAACAAGCACCTGGAGGGCCAAGGTTTCCATCGGTCAGCGG
CGGATCCGTGTGTGTATGTTCGGCGTTCGGACTCGAAGTTCAGCATCATTATCGTCTACGTGGACGACCTCATGATCTTCAGCAGGACGAAAGCGGAGAT
CGGTGAGATCAAGAAGGCGCTGAAGCGCGAGTTCAGCATCAAGGAGCTCGGTGAGCTGAAGTACTGTCTCGGCATCGAGATCCACCGCAACCGCGACGAC
AAGACCATCGTCATGAATCAGCGAGCGTATATTCAACGACTCGCGGAGAAGTTCGGCGTGGAAAAGTGCAAGGCAGTGCACACACCAGCGGACAGCAACT
CGAAGCTGGTGAAGCCGTCAGAAGACGAAGATTTCGTGCCCAGGTACCCGTATCGCGAGTTGGTGGGGGCTTTGATGTACCTCGCAACTTGTACGCGCCC
GGACATTGCTCAAGCTGTGGGTGAAGTGGCCAAGTTTTGCGAGCGGTACAACAAGTCTCACTGGGTGGCTGCGAAGCGGATTTTGAAGTACTTGAAGACC
ACTCAGGACCTGGGACTCGTGTTCAACGGCGGGACTAAGGGAGAGCTGATCGGCTACGCGGATGCGAACTGGGCAGGTGATTTGGACACCCGGCGCTCGA
CTACTGGCTACGTGTTCTTCCTGAACGGGAGTGCAATTTCGTGGAAGTCGAAGCGGCAACCGACAGTGGCAACCTCGAGCACGGAGGCAGAGTACATGGC
ACTGTACAACGCCACTCAAGAGGCAGTGTGGCTGCGTCAGCTACTACTGGACGTGGGGTGTGAGTGTGTGGGTGCGACTACCATTTTTCAGGACAACCAA
GGTTGCATTGCGCTGGCCAAGAATCCAGCGTACCACTCACGCACCAAGCACATCGACTTGAAGTATCACTTCTTGCGCGAGAAGGTGGAAGACAAAAGGA
AGTTGGGCTACGAGCTGCGGAGAGTTGAAAGCTTAGAAGACGGCTTCGGGCCGAGATTGCAAAACCAAAAGTGAGATTGATTGAGTGAGTTTTAGCTGCT
AGCCTGCCTCCTACGCTCTCTTGTCGGCAAAAAGAAAAACGTCCATGTGGGGACTCGAACCCACACCCTACGGATCAAAGACCCGGCACTTAACCCACTA
CACCATACTGCATGACCAAAGTCACGCACACCCTACTCCTACATATGTAACTCTTACTATGCACCCACACGCATGTCCACGCCGCTTCAGCACTTGGACA
CGCTCCCACACGCTTGTTCTCACGCGCACGCAACCTGCGCGTCTCATCATGAGCACTTGACGCCGCCACAAATC