Description :
From Genome Similarity Track
Location :
Scaffold_671:1- 5574
Transcript NameFunction/comments
g11105.t1hypothetical protein

Sequence
5573 bases(100 bases per row)
TTAGTGTATCGTACACGAATAGTGTGTTTCACACACTTGGTGTGCACACCCAAGTTGGTGTGTGTATACGAGACTTAGGATGGCGGCCTCACAGCTACCC
GTCATGCATATTACTAGGCTCTACTATGGTAGATAGTGAGTGTTATACATTGCGGCCTTGCCGCGAACAACAATAATACAAATCAGTTCACGTTTTGAAG
TCTAGTGTCTATTAACCTTATTTAAGGTATTAATAAGTCTAGGAGTCTGTAGATCGCATATCTACAGACTGTACTTGGTTCTGGTATAGAACCTAGGTTT
ACAACCGAACTAAGACTCTGAGAGTCTACGTCTTCCTCTGACGCAAGCTACGGCAACCCCGCTGCAGCATGACTTACTTGCGATTTGAAAAAGCATTTTT
GTGGCCCAACTCATGGTATCCAACTCAGGGCTGAGCAAGCATCACATTCTTTGGTAGCCGAAGTAGCACAAGCAGATATTTGAAGTGTTCCATGAAGTCA
CCTGCAAAATACTGCGAAGTGTAGCACGTTCCACGAACTCAAATGATTTTTTTGTGAGGTGTGTGGGCGTACGTGCTGATAATGGTTGCTTACGCTTTGC
GCGTCAGAGTGGGTCGGTTCGTAGGTTCAATGATCGTAGATCATTTCACGCAAGCTACTAAACCTACACTTTACAGATTAGAAGGGACATTACACGGTGG
TGAGATAGCACGTGTGAATCGAGAATTAAATTCCCGTGGGCGCTAACCAATTTAATTGTACAGTGCGAAGTGTAGTGAAATAGCCTTTCAAAAGCTGCCA
GTACAGCGAAGTGTCTAACCTAAAAGGCTCGTGGCAAGCGCATCACGTATCGCATCATTGATCGTGTACTTCAACCGCTATGAAGCGAGGCAGATGAGCC
TTTTTGCGAGAAACCGCGAGAACAACATGGATCTGTCGAGATACGCTTCCATCGTTTGATGCGCACATGACGAGTTGGTATGTTGGGAAACTTACAACAT
TTCCAGGGATTTTTGCATTCGTTGCGTTCATGGTACGTGCACATCCAACAAGGAAAACAGTAAGTTGGCGCGACAAGCCAGAATTAGTATGGACACTGTT
TGGACCGAAAGGATCGAATTTGAAATGTGAAGAAAAGTGTTTTGCGTAGCTCTGTGTAGACTATCGCTCGCAGTGGAAAGTTGAGAACGTGCAAATTTGC
ATTTTTTCAGTTGTAAATGAAGGTTGTGTGAAAAAGATGCAGATCCACCTTCAGCGCGACGCTCAACGCGCTTCCGCGCCCAGTATTTGTGAGACCTCAC
TTCACAATTTGTAGTCCCAAGTACAAGCGGCCGCACGCACATCCTTTCACCTCGCCATCCTCAACACTCTCGGCAAAGACAACAACACGCCTCCATGGAT
CTCCTGGACACTATTTGCCATGACGTTTTGAAGTAGAAGGAAGAAGAAGCGGTCAACTACGTCACCAGGGTCTCGGACTTCCGCGAGTTCGTCATGACGC
AGCCTGCATCGGACGCAAGCGTGACCATCAAGATGTGCTGTCTTTTAGTAGAGCGCCTCAATACTGAGGGAGGTACTCGGGTGACTATCATTGACGGCTC
CCAGCACGGTGTTTTCGAGCTCACGGGTTTCCGTCCAGGGGCTTTGTTCGAGCTCCGGCAGATCGACGGCATTGGCTTCTACGCGGACATTCCTATGGTC
GCTTGCAGTTCGAGAGTGACAGCGGCAAGATTATGGAGGTTCTGCCTCCAGCAATCAAGCGCAAGGCGTCGAGTGGACTTTCCAAGAAATGGGCTAAGGC
GAAGACGAAAGCTTCGACATCAAGTCAGAGTACTGCGGACGAGAATGAAGACGAAGACGTGTCCATGGAACTGAGAGCAAGACGGAGGAGTTGGTCGTAT
CGGCGCGAACTCGCAGCAATAGTGTTGCGTGCGCTTGATTTTCGCGGCGCCGGACACCAAAGGGCATGCATGTGCCGATGTAAGTACCCGATTACGGGCT
CTGTGAGGTAGGAGTAGTGTCGAGATACGCTGTATTATTGATGTCGAACAAGTGAGAGCAGGGTAGCTCGTAGTTTCCTATGATGACGGAGAGAAGATTA
TTGCTTTGAATGAAATTGTCTCTTTGGAGATGTTTGCTATTTGTTGTACAGTTTCAGTATGAAAACAGTGGTTCGAATATATCCCGTCCGCGCTGTACGA
TAAGGTAAGCGATGAAAATGGCATTTTCGTGTAAAAAGTGAAGATACAACGAAGACGCGTCGCGCTGGTAAGACTGCTGTCACTTTCTATCTCGCCGCGG
GTGCGATGCGACAGCTAACGTTGGATTCAGTTTTGGCTCGTGATGAAGGCGGTGTCGCCCAACGAATTGAGCGGCGTTAATATGGCGTACGTCTCAACAA
CGTATAATTTTTGAGTATGAGCTAATTTGCTACGGTTGGGAGTGCATCGTTCCGTGCTGCTAGCATTCGCAGAGTACGAAGATGTCGTGCAGAATGTGTA
TGTGTACAGGTCGCGGCATCAGCTGGAGCCCGTACGTTTAACTCGAGGAGGAACGATAATTAGATGTATGCACTGATTTTTACTAACTAAGAAAATGTGT
AGGATGAAGTTCCGTTCTGCAGCTGTGAGCCCCTTGCTGGAGTGAGCGAGACCTGTGACGAAAACTGCGAAAACCGCATCGTACGTTTAACAATAGGTGT
GATTTCTTTTGAGCTGTGGTCGTTGGGACTAGCGTACAGCAGACCCAAACAGAATGTGTTCGAGGCCACTGCTTCACGGGGCTGAATTGCCGAAATAAAC
GGGTGCAAAATGGTGTTCAAGCGCGACTTGCCCTTAGAAGCGTCGAAGGAAAAGCCATTGGTTTGTTTTCGGACGGCGCAAACGAGGAAGATGCTCTCGT
TGCACAGCATGTTGGGGAGGTGATCACGCGGAAAATGTATGTGGAACGCGAGCGGAAGTATGTACTTCTATTCGCTGTCATGCTTATTGGAACACTCTAA
CGGCTCTGCGGTTCGGATGCTTAAACACCTTGTGCATTCCACCAGGATTTACGGTCTGGTCGTGACGGTTGCTGGAGTTATTGACGCTCGTTGTTTTGGA
GGGATGGCACGCTTTGCGAATCATTCGTGCAACTCAAATTGTGAAGTTCAGGGGTGGGAAGTTGCGGGGTAAACGTGCTGCGGGTTGTTCGCAACGTGTG
ATATTGAAGGCGGTCATGAGATCACAATCAGTTATGGTAGCAGTCTGCCTGTAGAGAGTCAGCTGGGCAATAATGTTGTTTTGGTTCTGCATTATTAGTA
AATTGCTAAATGCTCATGTTCTCTGCTACCAGACTCTAGCACGATGTCTATGCGGTGAACCAAACTGCCGAGAGTTCGTCTAGCTGCATCAACATGACAT
CGGAGTAGATAAACTCCTCCGTTCAATACGTAGTGGTAGCTGTGTAAATTGCTCACGGGATGCACTAAAACATCGATCAGGTGAAATACAAAAATTAACA
GCGAAGACATGAAGTGTGGCAGGATTGTTTTTCCGTATCCGAATCAGCACACAGCAGCTGCGAATTGATGACGACATGGTATCCAAGGTTTTATTGAGCC
AGCAACGCGAAGTGTAGCATTATTAGATACGTTCCACGAACTCACATGATTTATTGTGAGGTGGTGGCTTCTGTGAAATGAAGAGTAGGTTACGATTCGC
GCGACAGAGTGGGTTGCTGTGTAGGTTCAATGGTGATGGAGTATTAGTAGGATCGATAGAATTTGAGCATTGTTGTGCATGCTCAAGAAGCTACAGCTTT
GGAAGATAATTGTGCGGTGGCAACTAGTGGTGTGAAGCGAGAATCAAATCTGTATAGGCGCTGTAATTTGTTTCAACTTCACAATGAGTAGCGAAATGTC
CACTCAAGTGTTATCGTCGCAGGAAAGTCTAGCCTGTCGAAGATAAAGGTACTTGGCTAACCCATCACGCGGGCCATTACATTGAATCTTTGATTTTCTA
CTTCAACCGCTCACGCAGTCACTGCGTCAGTGAGCCACCATACGTGGACATGAATGATTCACACCGACAGATATGAGATGGGTACATCAATTTAAGGTCG
AAGGATAGCAGTCGAGCGACTGCAGTACTGAAAATTTTACTCTAGTATTTATGCATTGCTGTCACCATGGGCTCGAGCCAGAAACCTATGACTCGGCGAG
GCAAGGCAGCTCGAAGAGCGCTTAAAGTTGCTGCGGGTATTAGTGTAGCTAAGTCGACACCACGTCGCTCACAACAGCATCAGCCAGAGGCATCTATTGT
AGATATAGAGCTGGCTAAGCAGGACGCCAGAATAGCGCGTTTCAACGAAACTAGGAAGCGAAATGTAGCGGTCCAGCTCCTACCTCCGGCCAAAACCCGA
CGATAGCGTGGAGCTGGGGTAGGTGCAAACGAAGCCGAGAACCTGGAGTCTGATAAAAAATGGTTGACAATATGTTGTTAAATTTGAAATAGTTCGCGGG
GAAGTTTAACTGTGCTAACATCGCTCATTTAATTGTAGATTTCTTCGCATCTATTGACAAGCCCTTGATTCGTGTGTGCGGTAGCTATGGAGAAATTGCA
AACTCCGATCAAGCTGTACGCAAACTGTATGACCCTGAGGCAGACTTCTTTAGTCCTCTTCAAAATGAGGCGGGTGTTGTGGAGATCGATGAATGGCTCG
TGCTAGATTCGTTCGATGGGGTTGATTCGATCCGGCTATGACGTAGGTGTTACTAATCACTACGAACATGCAACCCCCCCCCCCCCAAATTTTGCCGGTG
TAGTGGGTTTCGCATTGCAGCAGTGCCATGTGAACTCGCTGCTCTTAGCAGGATGGAGGCCAGACTCATGGGACTGGGGATATCATTCACTACATGCGTG
AATTTGTACCGTGAGGGGCAAGAATTCACGCGGGAGAACGCAATCCACTACTGGAACGACCCCGGCGAGGTGGTTCGAGAGCTACCCAGACCGCTGAAGG
AGTGTGGAGTCATCTTTCTGTCGTCAACATCGGACAGGACAACTAAATATTTTCGCGTTCGCCCGGATTTGATACGATGAGCATTGAAGTGGCTTATCGC
GAACAATTCTCTCTATAAGGACGTCGTTATCTCGGAAGAGATCCTTCGTGTTCTCACAGAAGTGGATGCAGATCGCGAGATACCCACTATACCTGTTTCA
GAGGATGAGGTACAAGAGCTGCGAGGTCAGGCCTGCCAAGTCAACGAGCGGTGTCAGCCGGACGCCGTACCGGTTGGTCTGGAACACGACAACTACAACG
CGTCAAACACGGGAATTCAAAGCATCAGCAGCACTGCCCACACAAGTATCACCGAGACCTTCAGTTTGAAACGATGACGACGGATGCAGCCGGCGATCCC
AAGCCTTAAAGTGTTCATCATGAACGCGATGAGAGAGAGCGGGGTATATCCGTTGAAAACACACCCGTCCGCCCCGACGATAATGTTGGCAATGCAAATT
TCACAAACACACATTCGGAATATAATATATCGCCCTCTTGCTCTACAGTTTCATGTTGTGCATGTACGTGCGA