Description :
From Genome Similarity Track
Location :
Scaffold_493:1- 5543
Transcript NameFunction/comments
Hyaar_Emoy2814219PREDICTED: uncharacterized protein LOC100809692

Sequence
5542 bases(100 bases per row)
GATAGCAGCGCGGCCCATCTTCCTAGTCTTCCGTTGAGGCCGGGGAATTGAACTAGCCAGGCTAGTGTCGAATATCTAGTGAGCACCTTGATCTCCTGGG
ATACTAGCATATTACAGCACACGTCCAAGATTCGAAGCAAGGCTAACACCTCTTTCTCCACCATGCCATAATTAATCTCATTTGGATTCAGTGTACGGCT
CGTGGATGTCACCAGCCAGTATACGCCATCATATTCCTGCAGCAGGGATGCCAACACTGCCCATTTGCTAGCATATACCACGATCACTGGAAGTCGATAT
GGGTAGTGTTTGAGGATCGGGGTAGTAGCGATCTTGGCCTTCAACATAGCGGATCAAGATCACCTCCTTGTAGGGTGCGATTGCTACCTCCTGACATTTC
ATCACGATCATCGATATGATTAATCTAAAAAAATATGCCTCTCGTTGCTCGTGCAACACAGATGCGTATACTGCAAAATCTTCAATAAAGCGACTGTAGT
AGTTCAGAATACCGAGGAACTATTGCGTGGAACGCAAAGTTGTAGGGAAGGGATGTTAACCAGCGATCCTAGATCCGTAGTATTAGCTTCCAACCCGGCC
AATGATACCTGATGACCCAGGTAATCCACCTTACGCCGTCCCCAGAAACTCTTAGTCAGGTTGATCATCGACAAATTCCATCAATTTCATACCGTCAGTA
GTCGCTCTACCTTGTTATACAAGGAAGTCCACGACGTAGCTGGTATCAATATATCGTCAATATAAGATCGTCTGCCCAGCACTGACGGCGTCTTATCGGT
TTCTGATTCTCCTTCGGTGAACACATCGGTCAACCTAGAGGAATCTGTTGTGTTCGCATCCTTACCTGCGCAGATCTTGAGATATAAATAAAGCGTTATC
AATTAAATACTGATAAATCTGTGGAGCGTTCTTCAGTCCAAAAGGCATCCACAACCATTCAAACGGACCCGAAGGTGTGATAAACGCAGAGATCAACTTT
GCTCGTTCGGTCATCTCTACCACCCAAAATCCACCAGCCATGTCCAATGAACAATACCACATTGCCTTGTTTATATGTTGCAACAATTCGCTAATAAGCG
GCATGAGATAAACCATCAAACGTGTTAGCTGATTCACTCGTCGATAGTCGATACATAGTCGGATATCTTCTCCATTCTTCTTAATAATCCCGACTATTGG
GCGACGCCCACGGCGATGTCAAAGGTTGAATAATCTTAGCCGACAACAGGCCTTTTATCACATCAGCCAACTTCTCACTAAATTCTGGCGCAACCGGTCG
CACGCGCGATAGGCCTTGCCTCTCCAACATCAATATCAAAAACGGCCCCACGTGCTGCAGGGGGTAGTGCATTTTCTTTTCCAATAAACAGGTGACGACT
CTTTCATATCAGTTGTCGCAAATCCTCTTGATCTTCTGATAATGGTATCCCAGGATCGCCAACCTGGACATCGTCTATCGCTATCTCTGTCGTAGATGTT
GTTACCTCCGGTAGCACAACCACATGCTGCTCCACATCTTCCGCGAACAGTTCGCCTTATTCGTGGTAATATATTGATTCAGCTGGTATATCTTCTTTCA
TCATTTCCTCGTCAATCGCAGCAGCTTCCGCGCGGTCGATCAATCGTGTGGAACGGCCATGCACTTCCCGATACTCGACCTTGATCTCATCTGGCTGACA
GTTGAACTATCCTTGTAGCGGATCAGTTGTCACATGGTCGACCTCCTGTGCTATGTCCCTCTTTGCAACCCCGTCTACTTCACTCGATCATTCTGGGGTC
TTTCGCACTGCATTGAACGCGCACGATCTCTTTGTCGATCTATTATCCTTGCCTTTGTTCTTCTTCTCACCCGTGTACTCGTCTTGAATCTCATCACTAG
TGTTACAATCAGGTTCGGATAGCGATGTGATCCCGGCAGAAACCTTGACGTCTTCTGATTCCTCCTTGGGTCGAGTTAAAATTCGGGTGGGTTTCTTGTA
CGTAGGATGATCCACTAGCGGTACCGCATATGCTTCCATCTCTTCTTCTTCTCGATCTGTAGTAGATTCAAAGGCCAATGTTTGCCATTATTCATACCGC
CGCAATCCGACGGATACATATCCCTGAGACCGCGGTGTCATGTCTTCTTTCATCCACAACGCTAAAGGGGCCCCGTAATTTAAGATCAAGTCGCGATCGC
TTAACCATTCCGGGCCCATTCGTCACGGTAGGAACCCATGCCACATCTCGCCTCACCCAAAGCTTGTATTTGAGGATTGACGCCGATCCTGACTTCATTC
GATCTACCGGCAGGGATGACAATATGTTGATCGTTAAGGTTGAGAACCAATAAATTCTATCGGTATGGCGGTCTCCACTTAGCCAAACAGATGCGAACCT
CGTCTAGTAGACACAGGATTCCGTCGGCCAAATCCAAACGGATGCCTGCCGGAACCATGAAGTCCATACCTAGTATGGATTCTTGACCAACTTGATCACC
AACCCAGACATCAAAATAGTATACTAGTGATCCTTCCGGTGTGATTTTGATCTTGGTCCTTCCCACCGTCATATAGACATTCTCCTCGATCCCGACGCAT
TCTTGCGTTCGGCTCTCGTCCAACACATCCTACCTTACAAGAAAAGGTTGTGTCGATGATCGAGATTTCCGCACCAGATTCAAACAGCAGGGTGACCTTC
TCATTGTTGATCTTGCCCACTGCTTTCGCTTGTTTGAACCATCTCCCCGGGGTATAATATTTCCAGTATCCCTTTGACTCTCCTGGGTCGGGATAGAGCT
CCATCTTTACAGGGGATCGGGAATAATCGTCCACTCGTTTCACACTTGATATAGAAGAAACAAATGTAGAACGATCACATATATCAGTGATTGGATCGCG
TCGATACTTAACTCTTTGATCCTCCAATCGTTTTTAACGAATGCATATATGCATAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAACCTGGCGAGCGTC
CTAGTTTAACATTTCGTCGACTTTCGGAGGAAACATCCCAGCCTTCTTGGTAGGAATGTACCACTTGCGGATCAAGCTATAGAACTCTTCCATGGGGCAC
TTGCCATTCTCATGCATCTCTCCGCAAGCTGCACACGCATATACACACTTGTCTGATGGATGTCCCTTGCTATCGCATCTGACACGTCAGTCTCTGCCAG
AATTCGCGATCGTCGTGGCTCTTCGATCCGCAATTAGTGCAGGCTTTCTCAAATGCGACGCATTCCGGACTATAGTCTTCACGATCATCATTGGTTGCAG
CACGTTGATATCCAAACTTCGTCGGGCGATCCGAGATCGCGGCCACAAAAACATTACGTAGTTCACGTTCCGAGTCCGATCCGCTAAGGTTGGATTCCGA
AGAACTGTCCGCATCCTCCACGTGAATGGAACTCATGGTACGCGATGGTTTAACCGGTGTTGGAGAAGCTGTGGGTGATGATCGTGGTCGAAATTTATTC
GCTTCCATGAGTGATTGAGCTTGTCGATCTTCCATGCGCTGGTAAGCGCGCAGGGTCTCCTCCATATCATCGACATCACCGATCCGTAACAGCGTCAGTT
GTTTGGCCAGATCAAAATATCCCAGGGTCCCAAAAAATTGTTCCACATGTTCACGACGAATGTCTGGGGATCCATCTCGAATTAGTATCTTTGCTCGATT
CGCTGGCACATTCAACCGATACAGATAACCCAGAGGCTTATCCTCCGGTCGCTTCTTGGCAAGGTAATATTGTCTTCCAACGGATATACCATTACCACCA
TTTTGCACGAGAAAGTTTTCCAGTAGGTCCTTCCACGAATGACAAGTAGATGGGCTCAGCTGACTGTGCCAATTTCTCGTCGGACCCGCAAGCAGATCTC
CAAATATTAAGCGCTTCTCCACATCTGGGGCTTGATCACTTAGGAAGGCAGACTTGACCTTGCCGATCCAGCTCCTGGCTCGATCCTCGTCTTTGGCCTT
CCCATTGAACTCTTTCATGTCTGAGATCGCAGATATTCGAATCCGCGGAGCGCTAAGTCCACCATCTGGCACTGTCTCCACAGTAGCCACAAGTGGTCGT
CTCGACTCGGCTTGCGCTGAGTTGTCGGGATCTCCTGCTCCACGATATTGTATTTCAGCGCCACCGTGATGCGATCCAGCCGATTCCATCTCAATATCAG
AGGTATAAGACTAGATATCCCCTTGCAATCTTGATCATCTGGCTTGGGTAAATTGATTGGCAGGCCTGATTATGGTGTTCTTGCTGAAATAGTTCCATGG
CAGCATCAAAATATGATTGTAGTTGTTCTTGGGTAGTCGAACCCGCATCTTCTTATAGCGCGTACGGGTGTTTATCGCGGTCCGCTCTCGATCCCTTCCC
CACGACCACGTAGATCATCCTTCTTTTCCATGCGATCGCGCAGATGAGCAGCTCCATTTGGGCCTAAAGACACTTGCTGAATGCCGATTAAGTCCCCTGA
CTCTACTTCAGATTCGGCTGATACATACTGGGATGATTCAGTGTGATATTCTCTGAACTTCTGCAGCCGTCGGTCCCACATGATCGCTCGCCGCAGTCGC
TTCCACATGATCGTCAGCTTTATGCATACCCGTCAAAGGGATTAACTTCTCTTACAGCAATTGGCACGCGTGTATCACGCGATCCTGTTCGCAATCCAAC
AGCTCTCTTGCGTCGAATGATCCCGCGACGAATCCTGGTTCGTTCAGCATCTGTATAAATCCCTTTATTCCATCCAGTGTGTTCGACGCGATCACTGTGG
ATGATATAGGGTCTTGAATTGTTCCAATCATCTTGGGCTTCAGTAACCGGAGCACCGGATCGTTCGCCAAGCACTTCTTGAGCGTCCTCCAGTGATACAT
CTCCTCCATCTGGTCCAGTTGCCAGCCTTCCATCTTCCCCTCATCTTCCACATACTTGATTGGTCTGATGGCCGATCTCGTCACGCGATCGGGGTGATCC
GATCCTGGCGCTGTCTTCTTCACTCGTGCAGTCTTCGACTTCTTCTTTTTTACGTTGCAGGAGTGATCTTAGATGGACTTTGTTCGGTTTTAACCGAAGG
GTTTTCACCCAGCGAATCATGCTTTGTAGCACGATCCGCGGTGGTCCCCGAAGGGAACTCAGGAGGGGGTTGGGGTGCAGATCGAGTGAATGATCTTCCT
CTTTTGTTTTCTTGTCATAAAAAAAGCACCTCCCAAAACTTTGACGAACCGAGGATCCTTTATCTTCACACGTCCGCGACTATCTCTCTTTTTCGGACGC
TCCAATACCAGGCTCAGTCTTGATCTTGACATCTTCTCCAAGCGAATCACGGTGAAATGCCAGGTCACCAAAAGATCCGGGCACGCGCACCATGGTGGTG
GAATGGATTCGCTCAATTGCTGATGCGATTTTGGCTGTCCACTGGAGCCCAGACGACCGACTAACAGGGGATACTCCGATTCCGTGTGCTTTGCCTTCCT
CACCTTGTGTACCCGTCGGTAAGGAAGGTTGCACACTTCCAG